Incidental Mutation 'R7012:Adcy4'
ID 545095
Institutional Source Beutler Lab
Gene Symbol Adcy4
Ensembl Gene ENSMUSG00000022220
Gene Name adenylate cyclase 4
Synonyms
MMRRC Submission 045113-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7012 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 56006514-56021552 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 56017376 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 266 (V266I)
Ref Sequence ENSEMBL: ENSMUSP00000130530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002398] [ENSMUST00000170223] [ENSMUST00000227031]
AlphaFold Q91WF3
Predicted Effect possibly damaging
Transcript: ENSMUST00000002398
AA Change: V266I

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000002398
Gene: ENSMUSG00000022220
AA Change: V266I

DomainStartEndE-ValueType
low complexity region 28 48 N/A INTRINSIC
low complexity region 66 80 N/A INTRINSIC
low complexity region 145 161 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 2.4e-35 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000170223
AA Change: V266I

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130530
Gene: ENSMUSG00000022220
AA Change: V266I

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
transmembrane domain 61 80 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 119 138 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 172 194 N/A INTRINSIC
CYCc 218 426 1.56e-62 SMART
Pfam:DUF1053 479 581 1.6e-24 PFAM
transmembrane domain 607 629 N/A INTRINSIC
transmembrane domain 661 683 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 746 768 N/A INTRINSIC
transmembrane domain 792 809 N/A INTRINSIC
CYCc 835 1057 4.46e-40 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227031
Meta Mutation Damage Score 0.0950 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of adenylate cyclases, which are membrane-associated enzymes that catalyze the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). Mouse studies show that adenylate cyclase 4, along with adenylate cyclases 2 and 3, is expressed in olfactory cilia, suggesting that several different adenylate cyclases may couple to olfactory receptors and that there may be multiple receptor-mediated mechanisms for the generation of cAMP signals. Alternative splicing results in transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for disruptions of this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,769,431 (GRCm39) F686L probably benign Het
Adgrb1 A G 15: 74,401,750 (GRCm39) T249A probably damaging Het
Adss1 A G 12: 112,600,670 (GRCm39) D213G probably benign Het
Ap1b1 T G 11: 4,980,963 (GRCm39) V453G probably damaging Het
Apold1 G A 6: 134,961,007 (GRCm39) G154R probably damaging Het
Birc5 A G 11: 117,740,262 (GRCm39) E29G probably benign Het
Clcn1 G A 6: 42,267,542 (GRCm39) R75H probably benign Het
Cngb1 T A 8: 95,984,583 (GRCm39) I868F possibly damaging Het
Cntn6 T A 6: 104,703,223 (GRCm39) V215E probably damaging Het
Cntn6 A G 6: 104,751,441 (GRCm39) I294V probably benign Het
Col6a2 A T 10: 76,450,511 (GRCm39) I140N possibly damaging Het
Cops5 A G 1: 10,100,890 (GRCm39) *147Q probably null Het
Dbr1 T A 9: 99,465,374 (GRCm39) Y317* probably null Het
Dock5 A C 14: 68,060,035 (GRCm39) V468G probably damaging Het
F13b A G 1: 139,444,096 (GRCm39) I477V probably benign Het
Fhad1 CGG CG 4: 141,645,602 (GRCm39) probably null Het
Git1 T C 11: 77,390,606 (GRCm39) L114P probably damaging Het
Greb1l G T 18: 10,529,707 (GRCm39) probably null Het
Itih4 A G 14: 30,612,706 (GRCm39) N244S probably benign Het
Lin28a A G 4: 133,746,040 (GRCm39) S5P probably damaging Het
Lipt1 T C 1: 37,915,060 (GRCm39) I372T probably benign Het
Lysmd4 A G 7: 66,875,765 (GRCm39) T143A probably benign Het
Muc16 T C 9: 18,406,914 (GRCm39) probably null Het
Or13c9 A G 4: 52,936,193 (GRCm39) L30P probably damaging Het
Or2y1g A T 11: 49,171,823 (GRCm39) M283L probably benign Het
Or5t16 A T 2: 86,819,051 (GRCm39) H156Q possibly damaging Het
Or6e1 A G 14: 54,519,674 (GRCm39) I226T possibly damaging Het
Pclo G A 5: 14,800,493 (GRCm39) G4438D unknown Het
Phlpp2 T A 8: 110,603,486 (GRCm39) F51I possibly damaging Het
Rab5c G A 11: 100,610,789 (GRCm39) R40C probably damaging Het
Rxfp2 T C 5: 150,004,659 (GRCm39) V711A probably benign Het
Sbno2 A T 10: 79,905,352 (GRCm39) probably benign Het
Setd2 T A 9: 110,376,751 (GRCm39) S189T probably damaging Het
Sez6 A G 11: 77,868,621 (GRCm39) N965S probably benign Het
Sh3d19 A G 3: 85,992,320 (GRCm39) N116S probably benign Het
Slc43a3 T C 2: 84,777,313 (GRCm39) Y221H probably damaging Het
Slco1a6 T C 6: 142,032,287 (GRCm39) I613V probably benign Het
Stag3 T A 5: 138,295,871 (GRCm39) probably null Het
Ston1 T C 17: 88,943,413 (GRCm39) M273T probably damaging Het
Tbc1d32 A T 10: 56,100,820 (GRCm39) Y53N probably damaging Het
Tmem132b T A 5: 125,775,654 (GRCm39) L376Q probably damaging Het
Trim60 A G 8: 65,453,043 (GRCm39) V402A possibly damaging Het
Tssk5 A C 15: 76,257,745 (GRCm39) N178K probably damaging Het
Ttll9 T C 2: 152,844,982 (GRCm39) I450T possibly damaging Het
Tyw1 T G 5: 130,306,571 (GRCm39) probably null Het
Usp16 T C 16: 87,255,632 (GRCm39) probably null Het
Vmn2r97 T C 17: 19,167,756 (GRCm39) V670A probably damaging Het
Vmn2r98 A G 17: 19,286,530 (GRCm39) N343D probably benign Het
Zfp472 T G 17: 33,196,220 (GRCm39) N98K probably benign Het
Other mutations in Adcy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00917:Adcy4 APN 14 56,011,120 (GRCm39) splice site probably null
IGL02406:Adcy4 APN 14 56,007,504 (GRCm39) missense possibly damaging 0.45
IGL02503:Adcy4 APN 14 56,008,962 (GRCm39) missense probably damaging 1.00
IGL02543:Adcy4 APN 14 56,006,627 (GRCm39) missense probably benign
IGL02616:Adcy4 APN 14 56,020,971 (GRCm39) splice site probably null
IGL03002:Adcy4 APN 14 56,011,013 (GRCm39) missense probably benign 0.31
IGL03026:Adcy4 APN 14 56,015,467 (GRCm39) missense probably damaging 1.00
IGL03190:Adcy4 APN 14 56,016,510 (GRCm39) missense probably damaging 1.00
IGL03247:Adcy4 APN 14 56,007,553 (GRCm39) missense probably damaging 1.00
stressed UTSW 14 56,016,556 (GRCm39) splice site probably null
IGL03098:Adcy4 UTSW 14 56,019,038 (GRCm39) missense probably null 0.82
R0098:Adcy4 UTSW 14 56,007,284 (GRCm39) missense possibly damaging 0.78
R0102:Adcy4 UTSW 14 56,008,990 (GRCm39) missense probably benign 0.29
R0396:Adcy4 UTSW 14 56,009,745 (GRCm39) missense probably benign 0.00
R0482:Adcy4 UTSW 14 56,012,029 (GRCm39) critical splice acceptor site probably null
R0634:Adcy4 UTSW 14 56,019,054 (GRCm39) missense probably benign
R0691:Adcy4 UTSW 14 56,010,104 (GRCm39) splice site probably benign
R0704:Adcy4 UTSW 14 56,010,213 (GRCm39) missense probably benign
R0815:Adcy4 UTSW 14 56,021,056 (GRCm39) missense probably damaging 1.00
R0863:Adcy4 UTSW 14 56,021,056 (GRCm39) missense probably damaging 1.00
R1446:Adcy4 UTSW 14 56,007,480 (GRCm39) critical splice donor site probably null
R1462:Adcy4 UTSW 14 56,015,765 (GRCm39) missense possibly damaging 0.78
R1462:Adcy4 UTSW 14 56,015,765 (GRCm39) missense possibly damaging 0.78
R1463:Adcy4 UTSW 14 56,016,396 (GRCm39) missense probably damaging 1.00
R1624:Adcy4 UTSW 14 56,019,384 (GRCm39) missense possibly damaging 0.68
R1799:Adcy4 UTSW 14 56,008,929 (GRCm39) missense probably benign 0.01
R1878:Adcy4 UTSW 14 56,007,362 (GRCm39) missense probably damaging 0.96
R2007:Adcy4 UTSW 14 56,015,770 (GRCm39) missense possibly damaging 0.45
R2156:Adcy4 UTSW 14 56,006,627 (GRCm39) missense probably benign 0.09
R2425:Adcy4 UTSW 14 56,015,474 (GRCm39) missense probably damaging 0.99
R2517:Adcy4 UTSW 14 56,019,403 (GRCm39) missense probably damaging 1.00
R3882:Adcy4 UTSW 14 56,012,003 (GRCm39) missense probably benign 0.27
R4021:Adcy4 UTSW 14 56,012,635 (GRCm39) splice site probably null
R4022:Adcy4 UTSW 14 56,012,635 (GRCm39) splice site probably null
R4411:Adcy4 UTSW 14 56,006,900 (GRCm39) missense probably damaging 1.00
R4530:Adcy4 UTSW 14 56,016,485 (GRCm39) missense probably damaging 1.00
R4560:Adcy4 UTSW 14 56,016,407 (GRCm39) splice site probably null
R4704:Adcy4 UTSW 14 56,012,482 (GRCm39) missense possibly damaging 0.91
R4780:Adcy4 UTSW 14 56,012,493 (GRCm39) missense probably benign 0.07
R4860:Adcy4 UTSW 14 56,019,384 (GRCm39) missense possibly damaging 0.68
R4860:Adcy4 UTSW 14 56,019,384 (GRCm39) missense possibly damaging 0.68
R4868:Adcy4 UTSW 14 56,011,179 (GRCm39) missense probably benign
R4890:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4920:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4948:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4952:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4953:Adcy4 UTSW 14 56,016,486 (GRCm39) missense probably damaging 1.00
R4987:Adcy4 UTSW 14 56,010,934 (GRCm39) missense probably benign 0.01
R4991:Adcy4 UTSW 14 56,010,922 (GRCm39) missense probably benign 0.03
R5080:Adcy4 UTSW 14 56,009,832 (GRCm39) missense probably damaging 0.98
R5620:Adcy4 UTSW 14 56,009,824 (GRCm39) nonsense probably null
R5652:Adcy4 UTSW 14 56,010,900 (GRCm39) missense probably benign
R5726:Adcy4 UTSW 14 56,021,118 (GRCm39) missense probably damaging 1.00
R5910:Adcy4 UTSW 14 56,016,470 (GRCm39) missense probably damaging 1.00
R5958:Adcy4 UTSW 14 56,016,556 (GRCm39) splice site probably null
R6280:Adcy4 UTSW 14 56,016,500 (GRCm39) missense probably damaging 1.00
R6318:Adcy4 UTSW 14 56,006,681 (GRCm39) missense probably damaging 1.00
R6598:Adcy4 UTSW 14 56,007,502 (GRCm39) missense probably benign 0.03
R6947:Adcy4 UTSW 14 56,015,848 (GRCm39) missense possibly damaging 0.92
R7147:Adcy4 UTSW 14 56,017,182 (GRCm39) missense probably damaging 1.00
R7386:Adcy4 UTSW 14 56,015,784 (GRCm39) missense probably damaging 1.00
R7414:Adcy4 UTSW 14 56,019,090 (GRCm39) missense probably benign 0.15
R7431:Adcy4 UTSW 14 56,010,129 (GRCm39) missense probably benign 0.01
R7490:Adcy4 UTSW 14 56,007,890 (GRCm39) missense possibly damaging 0.66
R7552:Adcy4 UTSW 14 56,010,922 (GRCm39) missense probably benign 0.00
R7672:Adcy4 UTSW 14 56,018,362 (GRCm39) missense probably benign 0.14
R8003:Adcy4 UTSW 14 56,019,092 (GRCm39) missense probably benign 0.00
R8042:Adcy4 UTSW 14 56,012,696 (GRCm39) missense probably benign 0.01
R8100:Adcy4 UTSW 14 56,009,722 (GRCm39) nonsense probably null
R8343:Adcy4 UTSW 14 56,012,697 (GRCm39) missense probably benign 0.02
R8801:Adcy4 UTSW 14 56,009,452 (GRCm39) missense probably benign 0.05
R8811:Adcy4 UTSW 14 56,010,221 (GRCm39) missense probably benign
R8993:Adcy4 UTSW 14 56,016,156 (GRCm39) missense probably damaging 1.00
R8993:Adcy4 UTSW 14 56,008,835 (GRCm39) missense probably null 1.00
R9026:Adcy4 UTSW 14 56,016,426 (GRCm39) missense probably damaging 1.00
X0025:Adcy4 UTSW 14 56,007,848 (GRCm39) missense probably damaging 1.00
Z1088:Adcy4 UTSW 14 56,018,413 (GRCm39) missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCTTGGCAATTTGGTCGAAC -3'
(R):5'- CTTGGTTATAGGGCACAGCAGG -3'

Sequencing Primer
(F):5'- TTTGGTCGAACTTGCCAAAGAGC -3'
(R):5'- CAGGGTAGGAGGGGTATCACTC -3'
Posted On 2019-05-13