Incidental Mutation 'R7012:Vmn2r98'
ID 545101
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.146) question?
Stock # R7012 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19053460-19082411 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 19066268 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 343 (N343D)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: N343D

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: N343D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox3 T C 5: 35,612,087 F686L probably benign Het
Adcy4 C T 14: 55,779,919 V266I possibly damaging Het
Adgrb1 A G 15: 74,529,901 T249A probably damaging Het
Adssl1 A G 12: 112,634,236 D213G probably benign Het
Ap1b1 T G 11: 5,030,963 V453G probably damaging Het
Apold1 G A 6: 134,984,044 G154R probably damaging Het
Birc5 A G 11: 117,849,436 E29G probably benign Het
Clcn1 G A 6: 42,290,608 R75H probably benign Het
Cngb1 T A 8: 95,257,955 I868F possibly damaging Het
Cntn6 T A 6: 104,726,262 V215E probably damaging Het
Cntn6 A G 6: 104,774,480 I294V probably benign Het
Col6a2 A T 10: 76,614,677 I140N possibly damaging Het
Cops5 A G 1: 10,030,665 *147Q probably null Het
Dbr1 T A 9: 99,583,321 Y317* probably null Het
Dock5 A C 14: 67,822,586 V468G probably damaging Het
F13b A G 1: 139,516,358 I477V probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Git1 T C 11: 77,499,780 L114P probably damaging Het
Greb1l G T 18: 10,529,707 probably null Het
Itih4 A G 14: 30,890,749 N244S probably benign Het
Lin28a A G 4: 134,018,729 S5P probably damaging Het
Lipt1 T C 1: 37,875,979 I372T probably benign Het
Lysmd4 A G 7: 67,226,017 T143A probably benign Het
Muc16 T C 9: 18,495,618 probably null Het
Olfr1101 A T 2: 86,988,707 H156Q possibly damaging Het
Olfr1393 A T 11: 49,280,996 M283L probably benign Het
Olfr271-ps1 A G 4: 52,936,193 L30P probably damaging Het
Olfr49 A G 14: 54,282,217 I226T possibly damaging Het
Pclo G A 5: 14,750,479 G4438D unknown Het
Phlpp2 T A 8: 109,876,854 F51I possibly damaging Het
Rab5c G A 11: 100,719,963 R40C probably damaging Het
Rxfp2 T C 5: 150,081,194 V711A probably benign Het
Sbno2 A T 10: 80,069,518 probably benign Het
Setd2 T A 9: 110,547,683 S189T probably damaging Het
Sez6 A G 11: 77,977,795 N965S probably benign Het
Sh3d19 A G 3: 86,085,013 N116S probably benign Het
Slc43a3 T C 2: 84,946,969 Y221H probably damaging Het
Slco1a6 T C 6: 142,086,561 I613V probably benign Het
Stag3 T A 5: 138,297,609 probably null Het
Ston1 T C 17: 88,635,985 M273T probably damaging Het
Tbc1d32 A T 10: 56,224,724 Y53N probably damaging Het
Tmem132b T A 5: 125,698,590 L376Q probably damaging Het
Trim60 A G 8: 65,000,391 V402A possibly damaging Het
Tssk5 A C 15: 76,373,545 N178K probably damaging Het
Ttll9 T C 2: 153,003,062 I450T possibly damaging Het
Tyw1 T G 5: 130,277,730 probably null Het
Usp16 T C 16: 87,458,744 probably null Het
Vmn2r97 T C 17: 18,947,494 V670A probably damaging Het
Zfp472 T G 17: 32,977,246 N98K probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19067198 splice site probably null
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19081163 missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19080769 missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19066270 missense probably benign
R8952:Vmn2r98 UTSW 17 19065269 missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19081219 missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19066515 missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19067255 missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19081234 missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19065403 missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGTGACATTGATTCACTAGAAGG -3'
(R):5'- CTCATCTCATGGAGGCTGTG -3'

Sequencing Primer
(F):5'- CATGTTATTGACAGAGCTGAT -3'
(R):5'- CACACCATTGTAAATACTTGTGCTC -3'
Posted On 2019-05-13