Mutagenetix > Incidental Mutation

Incidental Mutation 'R7012:Vmn2r98'

545101

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r98

Ensembl Gene

ENSMUSG00000096717

Gene Name

vomeronasal 2, receptor 98

Synonyms

EG224552

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R7012 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

19053460-19082411 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 19066268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 343 (N343D)

Ref Sequence

ENSEMBL: ENSMUSP00000131261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170424]

AlphaFold

E9PZ56

Predicted Effect

probably benign
Transcript: ENSMUST00000170424
AA Change: N343D

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: N343D

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	460	2.6e-35	PFAM
Pfam:NCD3G	509	562	7.4e-22	PFAM
Pfam:7tm_3	594	830	1.4e-52	PFAM
low complexity region	844	856	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (49/49)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acox3	T	C	5: 35,612,087	F686L	probably benign	Het
Adcy4	C	T	14: 55,779,919	V266I	possibly damaging	Het
Adgrb1	A	G	15: 74,529,901	T249A	probably damaging	Het
Adssl1	A	G	12: 112,634,236	D213G	probably benign	Het
Ap1b1	T	G	11: 5,030,963	V453G	probably damaging	Het
Apold1	G	A	6: 134,984,044	G154R	probably damaging	Het
Birc5	A	G	11: 117,849,436	E29G	probably benign	Het
Clcn1	G	A	6: 42,290,608	R75H	probably benign	Het
Cngb1	T	A	8: 95,257,955	I868F	possibly damaging	Het
Cntn6	T	A	6: 104,726,262	V215E	probably damaging	Het
Cntn6	A	G	6: 104,774,480	I294V	probably benign	Het
Col6a2	A	T	10: 76,614,677	I140N	possibly damaging	Het
Cops5	A	G	1: 10,030,665	*147Q	probably null	Het
Dbr1	T	A	9: 99,583,321	Y317*	probably null	Het
Dock5	A	C	14: 67,822,586	V468G	probably damaging	Het
F13b	A	G	1: 139,516,358	I477V	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Git1	T	C	11: 77,499,780	L114P	probably damaging	Het
Greb1l	G	T	18: 10,529,707		probably null	Het
Itih4	A	G	14: 30,890,749	N244S	probably benign	Het
Lin28a	A	G	4: 134,018,729	S5P	probably damaging	Het
Lipt1	T	C	1: 37,875,979	I372T	probably benign	Het
Lysmd4	A	G	7: 67,226,017	T143A	probably benign	Het
Muc16	T	C	9: 18,495,618		probably null	Het
Olfr1101	A	T	2: 86,988,707	H156Q	possibly damaging	Het
Olfr1393	A	T	11: 49,280,996	M283L	probably benign	Het
Olfr271-ps1	A	G	4: 52,936,193	L30P	probably damaging	Het
Olfr49	A	G	14: 54,282,217	I226T	possibly damaging	Het
Pclo	G	A	5: 14,750,479	G4438D	unknown	Het
Phlpp2	T	A	8: 109,876,854	F51I	possibly damaging	Het
Rab5c	G	A	11: 100,719,963	R40C	probably damaging	Het
Rxfp2	T	C	5: 150,081,194	V711A	probably benign	Het
Sbno2	A	T	10: 80,069,518		probably benign	Het
Setd2	T	A	9: 110,547,683	S189T	probably damaging	Het
Sez6	A	G	11: 77,977,795	N965S	probably benign	Het
Sh3d19	A	G	3: 86,085,013	N116S	probably benign	Het
Slc43a3	T	C	2: 84,946,969	Y221H	probably damaging	Het
Slco1a6	T	C	6: 142,086,561	I613V	probably benign	Het
Stag3	T	A	5: 138,297,609		probably null	Het
Ston1	T	C	17: 88,635,985	M273T	probably damaging	Het
Tbc1d32	A	T	10: 56,224,724	Y53N	probably damaging	Het
Tmem132b	T	A	5: 125,698,590	L376Q	probably damaging	Het
Trim60	A	G	8: 65,000,391	V402A	possibly damaging	Het
Tssk5	A	C	15: 76,373,545	N178K	probably damaging	Het
Ttll9	T	C	2: 153,003,062	I450T	possibly damaging	Het
Tyw1	T	G	5: 130,277,730		probably null	Het
Usp16	T	C	16: 87,458,744		probably null	Het
Vmn2r97	T	C	17: 18,947,494	V670A	probably damaging	Het
Zfp472	T	G	17: 32,977,246	N98K	probably benign	Het

Other mutations in Vmn2r98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Vmn2r98	APN	17	19065745	splice site	probably benign
IGL01296:Vmn2r98	APN	17	19065185	missense	probably damaging	1.00
IGL01363:Vmn2r98	APN	17	19065758	missense	probably benign	0.01
IGL01618:Vmn2r98	APN	17	19065259	missense	possibly damaging	0.93
IGL01746:Vmn2r98	APN	17	19066451	missense	probably damaging	1.00
IGL01747:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01770:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01868:Vmn2r98	APN	17	19066286	missense	probably benign
IGL02123:Vmn2r98	APN	17	19080679	missense	probably damaging	1.00
IGL02323:Vmn2r98	APN	17	19065851	missense	probably damaging	0.99
IGL02543:Vmn2r98	APN	17	19065821	missense	probably benign
IGL02650:Vmn2r98	APN	17	19080961	missense	probably benign	0.00
IGL02676:Vmn2r98	APN	17	19065259	missense	probably benign	0.00
IGL02803:Vmn2r98	APN	17	19066013	missense	probably benign
IGL02807:Vmn2r98	APN	17	19081021	missense	probably damaging	1.00
IGL03307:Vmn2r98	APN	17	19065980	missense	possibly damaging	0.62
IGL03396:Vmn2r98	APN	17	19069845	missense	possibly damaging	0.92
PIT4131001:Vmn2r98	UTSW	17	19080961	missense	probably benign	0.00
R0122:Vmn2r98	UTSW	17	19066400	missense	probably benign	0.06
R0329:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0330:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0368:Vmn2r98	UTSW	17	19065827	nonsense	probably null
R0545:Vmn2r98	UTSW	17	19053613	missense	probably benign	0.15
R0635:Vmn2r98	UTSW	17	19080497	missense	probably benign	0.00
R0689:Vmn2r98	UTSW	17	19080520	missense	possibly damaging	0.83
R1035:Vmn2r98	UTSW	17	19080749	missense	possibly damaging	0.90
R1243:Vmn2r98	UTSW	17	19065948	missense	possibly damaging	0.52
R1421:Vmn2r98	UTSW	17	19065178	missense	probably damaging	1.00
R1629:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R1643:Vmn2r98	UTSW	17	19080908	missense	probably damaging	1.00
R1795:Vmn2r98	UTSW	17	19066440	missense	probably damaging	1.00
R1958:Vmn2r98	UTSW	17	19066418	missense	possibly damaging	0.70
R1962:Vmn2r98	UTSW	17	19065333	nonsense	probably null
R2165:Vmn2r98	UTSW	17	19081291	missense	unknown
R2238:Vmn2r98	UTSW	17	19065951	missense	probably damaging	1.00
R2252:Vmn2r98	UTSW	17	19080436	missense	probably benign	0.00
R2323:Vmn2r98	UTSW	17	19065819	missense	probably benign	0.18
R2887:Vmn2r98	UTSW	17	19081177	missense	possibly damaging	0.83
R2909:Vmn2r98	UTSW	17	19067402	missense	probably damaging	1.00
R3001:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3002:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3003:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3788:Vmn2r98	UTSW	17	19080625	missense	probably benign	0.31
R4570:Vmn2r98	UTSW	17	19066092	missense	probably benign	0.11
R4706:Vmn2r98	UTSW	17	19069745	missense	probably damaging	1.00
R4723:Vmn2r98	UTSW	17	19066340	missense	probably benign	0.01
R5036:Vmn2r98	UTSW	17	19066157	missense	probably benign	0.00
R5072:Vmn2r98	UTSW	17	19066044	missense	probably benign	0.07
R5121:Vmn2r98	UTSW	17	19053553	missense	probably benign	0.13
R5283:Vmn2r98	UTSW	17	19080719	missense	probably benign	0.05
R5294:Vmn2r98	UTSW	17	19069754	nonsense	probably null
R5371:Vmn2r98	UTSW	17	19069753	missense	probably damaging	1.00
R5532:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R5598:Vmn2r98	UTSW	17	19080899	missense	probably benign	0.37
R5800:Vmn2r98	UTSW	17	19065998	missense	probably benign	0.17
R6089:Vmn2r98	UTSW	17	19066074	missense	probably benign	0.29
R6155:Vmn2r98	UTSW	17	19065881	missense	possibly damaging	0.87
R6853:Vmn2r98	UTSW	17	19065801	missense	probably benign	0.00
R6920:Vmn2r98	UTSW	17	19065248	missense	probably damaging	0.98
R7042:Vmn2r98	UTSW	17	19080922	missense	probably benign
R7068:Vmn2r98	UTSW	17	19065313	missense	probably benign
R7607:Vmn2r98	UTSW	17	19067308	missense	possibly damaging	0.95
R7763:Vmn2r98	UTSW	17	19080535	missense	probably benign	0.00
R7771:Vmn2r98	UTSW	17	19067198	splice site	probably null
R7915:Vmn2r98	UTSW	17	19067231	missense	probably benign	0.10
R8028:Vmn2r98	UTSW	17	19053650	missense	probably benign	0.00
R8205:Vmn2r98	UTSW	17	19081163	missense	probably damaging	0.99
R8241:Vmn2r98	UTSW	17	19080769	missense	probably damaging	0.99
R8906:Vmn2r98	UTSW	17	19066270	missense	probably benign
R8952:Vmn2r98	UTSW	17	19065269	missense	possibly damaging	0.76
R9147:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9148:Vmn2r98	UTSW	17	19066121	missense	probably benign	0.04
R9187:Vmn2r98	UTSW	17	19081219	missense	probably damaging	1.00
R9344:Vmn2r98	UTSW	17	19066515	missense	probably benign	0.14
R9467:Vmn2r98	UTSW	17	19067255	missense	probably benign	0.01
R9487:Vmn2r98	UTSW	17	19081234	missense	possibly damaging	0.78
R9753:Vmn2r98	UTSW	17	19065403	missense	probably benign	0.27
Z1177:Vmn2r98	UTSW	17	19065136	critical splice acceptor site	probably null
Z1177:Vmn2r98	UTSW	17	19067423	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGGTGACATTGATTCACTAGAAGG -3'
(R):5'- CTCATCTCATGGAGGCTGTG -3'

Sequencing Primer
(F):5'- CATGTTATTGACAGAGCTGAT -3'
(R):5'- CACACCATTGTAAATACTTGTGCTC -3'

Posted On

2019-05-13