Incidental Mutation 'R7013:Fam20b'
ID545106
Institutional Source Beutler Lab
Gene Symbol Fam20b
Ensembl Gene ENSMUSG00000033557
Gene Namefamily with sequence similarity 20, member B
SynonymsC530043G21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location156678532-156719086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 156690565 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 220 (S220P)
Ref Sequence ENSEMBL: ENSMUSP00000112534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086153] [ENSMUST00000122424]
Predicted Effect probably damaging
Transcript: ENSMUST00000086153
AA Change: S220P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083322
Gene: ENSMUSG00000033557
AA Change: S220P

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:Fam20C 188 399 3.1e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122424
AA Change: S220P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112534
Gene: ENSMUSG00000033557
AA Change: S220P

DomainStartEndE-ValueType
transmembrane domain 7 25 N/A INTRINSIC
Pfam:DUF1193 187 402 2e-95 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality associated with decreased embryo size, multisystem organ hypoplasia, and delayed skeleton, digestive system, eye, liver, and lung development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Fam20b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01611:Fam20b APN 1 156702465 missense probably benign 0.13
consequences UTSW 1 156690553 missense probably damaging 1.00
Head_over_heels UTSW 1 156690570 missense probably damaging 1.00
minuscule UTSW 1 156705740 missense probably damaging 1.00
squirt UTSW 1 156705729 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0105:Fam20b UTSW 1 156690570 missense probably damaging 1.00
R0389:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0443:Fam20b UTSW 1 156681453 missense probably benign 0.00
R0518:Fam20b UTSW 1 156687456 missense possibly damaging 0.70
R1466:Fam20b UTSW 1 156686188 splice site probably benign
R1584:Fam20b UTSW 1 156686188 splice site probably benign
R2014:Fam20b UTSW 1 156705941 missense possibly damaging 0.92
R4085:Fam20b UTSW 1 156705875 missense probably benign 0.01
R4755:Fam20b UTSW 1 156687496 nonsense probably null
R5254:Fam20b UTSW 1 156705740 missense probably damaging 1.00
R5471:Fam20b UTSW 1 156705729 missense probably damaging 1.00
R6886:Fam20b UTSW 1 156690511 missense probably damaging 1.00
R6944:Fam20b UTSW 1 156687521 missense probably benign 0.02
R7205:Fam20b UTSW 1 156702398 critical splice donor site probably null
R7215:Fam20b UTSW 1 156690553 missense probably damaging 1.00
R7286:Fam20b UTSW 1 156681442 missense probably benign 0.28
R7684:Fam20b UTSW 1 156690645 missense probably benign 0.18
R8036:Fam20b UTSW 1 156705837 missense not run
Predicted Primers PCR Primer
(F):5'- TTAACTCTTGGTCAGGTGGC -3'
(R):5'- ACCTACGTAGGAAAATACATGTGTG -3'

Sequencing Primer
(F):5'- CAGGTGGCTGGCTCCTATTGAG -3'
(R):5'- CATGTGTGAAATGGACTAACATCAG -3'
Posted On2019-05-13