Incidental Mutation 'R7013:Olfr1252'
ID545109
Institutional Source Beutler Lab
Gene Symbol Olfr1252
Ensembl Gene ENSMUSG00000110819
Gene Nameolfactory receptor 1252
SynonymsMOR231-22_p, GA_x6K02T2Q125-51162884-51161940
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.619) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location89719575-89725012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89721386 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 242 (I242F)
Ref Sequence ENSEMBL: ENSMUSP00000150304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000186710] [ENSMUST00000213196] [ENSMUST00000216203]
Predicted Effect probably benign
Transcript: ENSMUST00000186710
AA Change: I242F

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140045
Gene: ENSMUSG00000110819
AA Change: I242F

DomainStartEndE-ValueType
Pfam:7tm_1 39 285 5.1e-28 PFAM
Pfam:7tm_4 137 278 1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213196
AA Change: I242F

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000216203
AA Change: I242F

PolyPhen 2 Score 0.205 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Olfr1252
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr1252 APN 2 89721526 missense probably damaging 1.00
PIT4151001:Olfr1252 UTSW 2 89721893 missense probably benign 0.42
R1838:Olfr1252 UTSW 2 89721709 missense probably damaging 0.99
R1866:Olfr1252 UTSW 2 89721206 missense probably benign 0.00
R3835:Olfr1252 UTSW 2 89721455 missense possibly damaging 0.75
R4577:Olfr1252 UTSW 2 89722043 missense possibly damaging 0.80
R4675:Olfr1252 UTSW 2 89721494 missense probably benign
R4799:Olfr1252 UTSW 2 89721362 missense probably benign 0.24
R4845:Olfr1252 UTSW 2 89721776 missense probably benign 0.05
R5076:Olfr1252 UTSW 2 89721401 missense probably damaging 1.00
R5160:Olfr1252 UTSW 2 89721419 missense probably damaging 0.99
R5384:Olfr1252 UTSW 2 89721305 missense possibly damaging 0.94
R5418:Olfr1252 UTSW 2 89721999 missense probably benign
R5763:Olfr1252 UTSW 2 89722028 missense probably benign 0.00
R6997:Olfr1252 UTSW 2 89721925 missense possibly damaging 0.71
R7500:Olfr1252 UTSW 2 89721937 missense possibly damaging 0.90
R7608:Olfr1252 UTSW 2 89721298 missense probably benign 0.42
R7671:Olfr1252 UTSW 2 89721259 missense probably damaging 1.00
R7781:Olfr1252 UTSW 2 89721535 missense probably benign 0.38
R7841:Olfr1252 UTSW 2 89721965 missense probably benign 0.06
R7999:Olfr1252 UTSW 2 89722000 missense probably benign 0.06
R8147:Olfr1252 UTSW 2 89721842 missense probably damaging 1.00
R8882:Olfr1252 UTSW 2 89721396 nonsense probably null
X0064:Olfr1252 UTSW 2 89721356 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATATTTTACTCCACAGCTTTGCC -3'
(R):5'- GGACCCAATGTCATTGACCAC -3'

Sequencing Primer
(F):5'- GCTTTGCCATACAAATTTTAATCTCC -3'
(R):5'- GTGACATGTACCCATTGCTAGGAC -3'
Posted On2019-05-13