Incidental Mutation 'R7013:Ttbk2'
ID545113
Institutional Source Beutler Lab
Gene Symbol Ttbk2
Ensembl Gene ENSMUSG00000090100
Gene Nametau tubulin kinase 2
SynonymsB930008N24Rik, 2610507N02Rik, TTK
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120732816-120850604 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120745784 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 904 (N904S)
Ref Sequence ENSEMBL: ENSMUSP00000028740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028740] [ENSMUST00000057135] [ENSMUST00000085840] [ENSMUST00000131389] [ENSMUST00000143051]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028740
AA Change: N904S

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028740
Gene: ENSMUSG00000090100
AA Change: N904S

DomainStartEndE-ValueType
Pfam:Pkinase 90 347 7e-31 PFAM
Pfam:Pkinase_Tyr 90 348 8.2e-19 PFAM
low complexity region 369 383 N/A INTRINSIC
low complexity region 1143 1156 N/A INTRINSIC
low complexity region 1205 1242 N/A INTRINSIC
low complexity region 1254 1271 N/A INTRINSIC
low complexity region 1285 1309 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000057135
AA Change: N835S

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000055032
Gene: ENSMUSG00000090100
AA Change: N835S

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085840
AA Change: N835S

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000083001
Gene: ENSMUSG00000090100
AA Change: N835S

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 1.2e-32 PFAM
Pfam:Pkinase_Tyr 21 280 3.8e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
low complexity region 1074 1087 N/A INTRINSIC
low complexity region 1136 1173 N/A INTRINSIC
low complexity region 1185 1202 N/A INTRINSIC
low complexity region 1216 1240 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131389
SMART Domains Protein: ENSMUSP00000118905
Gene: ENSMUSG00000090100

DomainStartEndE-ValueType
Pfam:Pkinase 21 145 1.3e-18 PFAM
Pfam:Pkinase_Tyr 21 148 9.7e-12 PFAM
Pfam:Pkinase 145 239 1.2e-5 PFAM
low complexity region 265 279 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000143051
AA Change: N835S

PolyPhen 2 Score 0.689 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000121996
Gene: ENSMUSG00000090100
AA Change: N835S

DomainStartEndE-ValueType
Pfam:Pkinase 21 274 2.4e-32 PFAM
Pfam:Pkinase_Tyr 21 280 7.7e-19 PFAM
low complexity region 300 314 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine-threonine kinase that putatively phosphorylates tau and tubulin proteins. Mutations in this gene cause spinocerebellar ataxia type 11 (SCA11); a neurodegenerative disease characterized by progressive ataxia and atrophy of the cerebellum and brainstem. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit complete preweaning lethality, decreased embryo size, growth retardation, and incomplete turning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Ttbk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Ttbk2 APN 2 120748833 nonsense probably null
IGL00484:Ttbk2 APN 2 120773886 nonsense probably null
IGL00767:Ttbk2 APN 2 120745745 missense probably benign
IGL00809:Ttbk2 APN 2 120760269 missense probably damaging 1.00
IGL01484:Ttbk2 APN 2 120739833 missense possibly damaging 0.95
IGL01974:Ttbk2 APN 2 120786083 missense probably damaging 1.00
IGL02488:Ttbk2 APN 2 120755871 missense probably benign 0.00
IGL02874:Ttbk2 APN 2 120745712 missense probably damaging 0.99
IGL02893:Ttbk2 APN 2 120783729 missense probably damaging 1.00
IGL03210:Ttbk2 APN 2 120822492 missense probably damaging 0.99
R0279:Ttbk2 UTSW 2 120748960 missense probably benign 0.00
R0362:Ttbk2 UTSW 2 120745783 missense possibly damaging 0.90
R0376:Ttbk2 UTSW 2 120777581 missense probably damaging 1.00
R0400:Ttbk2 UTSW 2 120750242 missense probably benign 0.02
R0601:Ttbk2 UTSW 2 120825296 missense possibly damaging 0.73
R0606:Ttbk2 UTSW 2 120773872 missense probably damaging 1.00
R0664:Ttbk2 UTSW 2 120748821 missense probably damaging 0.99
R0718:Ttbk2 UTSW 2 120745160 missense probably benign 0.00
R0718:Ttbk2 UTSW 2 120748575 missense probably benign 0.01
R0783:Ttbk2 UTSW 2 120739977 missense possibly damaging 0.74
R0906:Ttbk2 UTSW 2 120783781 missense probably damaging 1.00
R1141:Ttbk2 UTSW 2 120806851 missense probably damaging 1.00
R1363:Ttbk2 UTSW 2 120806908 critical splice acceptor site probably null
R1420:Ttbk2 UTSW 2 120745912 missense probably benign 0.00
R1734:Ttbk2 UTSW 2 120755838 missense probably benign 0.01
R2033:Ttbk2 UTSW 2 120806849 missense probably damaging 0.98
R2047:Ttbk2 UTSW 2 120748916 missense probably damaging 0.99
R2893:Ttbk2 UTSW 2 120745610 unclassified probably null
R3783:Ttbk2 UTSW 2 120773815 splice site probably benign
R3785:Ttbk2 UTSW 2 120773815 splice site probably benign
R3870:Ttbk2 UTSW 2 120740019 missense probably damaging 1.00
R4024:Ttbk2 UTSW 2 120760255 missense possibly damaging 0.91
R4039:Ttbk2 UTSW 2 120745795 missense probably benign 0.01
R4060:Ttbk2 UTSW 2 120748984 missense probably benign 0.26
R4624:Ttbk2 UTSW 2 120773323 missense probably benign 0.19
R4634:Ttbk2 UTSW 2 120740192 missense probably damaging 1.00
R4708:Ttbk2 UTSW 2 120739861 missense probably damaging 1.00
R4727:Ttbk2 UTSW 2 120745370 missense probably benign 0.01
R4811:Ttbk2 UTSW 2 120740070 missense possibly damaging 0.62
R4962:Ttbk2 UTSW 2 120745150 missense probably damaging 1.00
R4964:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R4966:Ttbk2 UTSW 2 120773277 missense possibly damaging 0.66
R5369:Ttbk2 UTSW 2 120825262 start gained probably benign
R5430:Ttbk2 UTSW 2 120777565 missense probably damaging 1.00
R5607:Ttbk2 UTSW 2 120806824 missense possibly damaging 0.89
R5812:Ttbk2 UTSW 2 120822559 missense probably damaging 0.99
R5898:Ttbk2 UTSW 2 120745040 missense probably benign 0.08
R5951:Ttbk2 UTSW 2 120773283 missense probably benign 0.02
R6135:Ttbk2 UTSW 2 120750317 missense probably damaging 1.00
R6889:Ttbk2 UTSW 2 120773353 missense probably damaging 1.00
R6907:Ttbk2 UTSW 2 120825270 missense probably benign 0.00
R7128:Ttbk2 UTSW 2 120746088 missense probably benign 0.00
R7173:Ttbk2 UTSW 2 120740111 missense probably damaging 1.00
R7358:Ttbk2 UTSW 2 120790310 missense probably damaging 1.00
R7475:Ttbk2 UTSW 2 120748640 missense probably benign 0.01
R7891:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
R7974:Ttbk2 UTSW 2 120786029 missense probably damaging 1.00
RF010:Ttbk2 UTSW 2 120790339 nonsense probably null
RF021:Ttbk2 UTSW 2 120748634 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTGGCAAGCTTTCACTC -3'
(R):5'- GACCCTCCTGACCATAATAGATTAGC -3'

Sequencing Primer
(F):5'- GGCAAGCTTTCACTCTGAATAC -3'
(R):5'- AGAATTTGAACATCTCCCTGGAG -3'
Posted On2019-05-13