Incidental Mutation 'R7013:Bank1'
ID545116
Institutional Source Beutler Lab
Gene Symbol Bank1
Ensembl Gene ENSMUSG00000037922
Gene NameB cell scaffold protein with ankyrin repeats 1
SynonymsA530094C12Rik
MMRRC Submission
Accession Numbers

Genbank: NM_001033350.2

Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location136053363-136326066 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136100509 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 455 (S455P)
Ref Sequence ENSEMBL: ENSMUSP00000035484 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041577] [ENSMUST00000196159] [ENSMUST00000198206]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041577
AA Change: S455P

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035484
Gene: ENSMUSG00000037922
AA Change: S455P

DomainStartEndE-ValueType
DBB 197 327 1.24e-62 SMART
Blast:ANK 341 371 7e-12 BLAST
SCOP:d1awcb_ 344 398 2e-4 SMART
Blast:ANK 377 407 2e-6 BLAST
coiled coil region 465 486 N/A INTRINSIC
low complexity region 502 515 N/A INTRINSIC
coiled coil region 560 583 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196159
AA Change: S322P

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142366
Gene: ENSMUSG00000037922
AA Change: S322P

DomainStartEndE-ValueType
DBB 64 194 1.24e-62 SMART
Blast:ANK 208 238 6e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 3e-6 BLAST
coiled coil region 332 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 427 450 N/A INTRINSIC
low complexity region 476 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198206
SMART Domains Protein: ENSMUSP00000142996
Gene: ENSMUSG00000037922

DomainStartEndE-ValueType
DBB 64 194 5.9e-67 SMART
Blast:ANK 208 238 5e-12 BLAST
SCOP:d1awcb_ 211 265 1e-4 SMART
Blast:ANK 244 274 2e-6 BLAST
low complexity region 300 313 N/A INTRINSIC
coiled coil region 359 382 N/A INTRINSIC
low complexity region 408 421 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a B-cell-specific scaffold protein that functions in B-cell receptor-induced calcium mobilization from intracellular stores. This protein can also promote Lyn-mediated tyrosine phosphorylation of inositol 1,4,5-trisphosphate receptors. Polymorphisms in this gene are associated with susceptibility to systemic lupus erythematosus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased germinal center formation and IgM production in response to T-dependent antigens, and show enhanced CD40-mediated B cell proliferative and survival responses. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Targeted, other(1)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Lnpep C A 17: 17,568,363 M493I probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Bank1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Bank1 APN 3 136247634 missense probably damaging 0.99
IGL03088:Bank1 APN 3 136093362 missense probably damaging 0.98
IGL03190:Bank1 APN 3 136100424 missense probably damaging 1.00
I2289:Bank1 UTSW 3 136054418 missense probably damaging 1.00
PIT4504001:Bank1 UTSW 3 136100419 missense probably damaging 1.00
R0193:Bank1 UTSW 3 136066518 splice site probably benign
R0423:Bank1 UTSW 3 136284017 missense possibly damaging 0.68
R0518:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0521:Bank1 UTSW 3 136213942 missense probably damaging 1.00
R0587:Bank1 UTSW 3 136214037 splice site probably benign
R0628:Bank1 UTSW 3 136066390 missense probably damaging 1.00
R0723:Bank1 UTSW 3 136054403 splice site probably null
R0811:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R0812:Bank1 UTSW 3 136093366 missense probably damaging 1.00
R1101:Bank1 UTSW 3 136283864 missense probably benign 0.08
R1446:Bank1 UTSW 3 136064143 missense probably damaging 1.00
R1564:Bank1 UTSW 3 136213841 nonsense probably null
R1636:Bank1 UTSW 3 136083226 missense probably damaging 1.00
R1667:Bank1 UTSW 3 136093296 missense probably damaging 1.00
R1751:Bank1 UTSW 3 136234614 missense probably benign 0.00
R1751:Bank1 UTSW 3 136254937 missense probably benign 0.00
R2023:Bank1 UTSW 3 136325918 missense probably benign 0.02
R2851:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R2852:Bank1 UTSW 3 136242940 missense possibly damaging 0.92
R3411:Bank1 UTSW 3 136247773 splice site probably benign
R4422:Bank1 UTSW 3 136083211 missense probably damaging 0.99
R4499:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4693:Bank1 UTSW 3 136247676 missense probably damaging 0.99
R4744:Bank1 UTSW 3 136247689 missense probably benign 0.12
R4791:Bank1 UTSW 3 136254929 missense probably benign 0.00
R4911:Bank1 UTSW 3 136284243 missense probably benign 0.44
R4967:Bank1 UTSW 3 136066373 missense probably damaging 1.00
R4979:Bank1 UTSW 3 136254901 missense probably damaging 0.99
R5119:Bank1 UTSW 3 136234682 missense possibly damaging 0.67
R5284:Bank1 UTSW 3 136064154 missense probably damaging 1.00
R5547:Bank1 UTSW 3 136066349 missense probably damaging 0.99
R5610:Bank1 UTSW 3 136066387 missense probably damaging 1.00
R6012:Bank1 UTSW 3 136213837 missense probably benign 0.44
R6087:Bank1 UTSW 3 136066429 missense probably damaging 1.00
R6753:Bank1 UTSW 3 136093308 missense probably damaging 1.00
R6764:Bank1 UTSW 3 136242940 missense probably damaging 0.97
R6861:Bank1 UTSW 3 136255003 missense probably benign 0.33
R7436:Bank1 UTSW 3 136055800 missense possibly damaging 0.76
V1662:Bank1 UTSW 3 136054418 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTTCTAGCTGGGAGGCAG -3'
(R):5'- GTGGGCAGCTTCTTACTATATAGCAG -3'

Sequencing Primer
(F):5'- AGCAGTGCCTGGTCGTG -3'
(R):5'- AACACCTTCCAGACAGTG -3'
Posted On2019-05-13