Mutagenetix > Incidental Mutation

Incidental Mutation 'R0609:Cit'

54513

Institutional Source

Beutler Lab

Gene Symbol

Cit

Ensembl Gene

ENSMUSG00000029516

Gene Name

citron

Synonyms

CRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase

MMRRC Submission

038798-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.947) question?

Stock #

R0609 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

115845278-116008947 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 115873943 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 203 (A203V)

Ref Sequence

ENSEMBL: ENSMUSP00000099620 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000137952] [ENSMUST00000141101] [ENSMUST00000148245]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000051704
AA Change: A203V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: A203V

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	891	905	N/A	INTRINSIC
low complexity region	915	948	N/A	INTRINSIC
low complexity region	950	968	N/A	INTRINSIC
low complexity region	1068	1081	N/A	INTRINSIC
low complexity region	1138	1156	N/A	INTRINSIC
low complexity region	1182	1203	N/A	INTRINSIC
internal_repeat_1	1243	1282	1.05e-5	PROSPERO
low complexity region	1353	1364	N/A	INTRINSIC
C1	1389	1437	1.97e-9	SMART
PH	1470	1591	1.31e-8	SMART
CNH	1618	1915	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000102560
AA Change: A203V

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: A203V

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1244	N/A	INTRINSIC
coiled coil region	1297	1338	N/A	INTRINSIC
low complexity region	1368	1379	N/A	INTRINSIC
C1	1404	1452	1.97e-9	SMART
PH	1485	1606	1.31e-8	SMART
CNH	1633	1930	1.78e-112	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112008
AA Change: A203V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: A203V

Domain	Start	End	E-Value	Type
S_TKc	97	359	2.92e-89	SMART
S_TK_X	360	422	6.32e-16	SMART
coiled coil region	452	1202	N/A	INTRINSIC
coiled coil region	1255	1296	N/A	INTRINSIC
low complexity region	1326	1337	N/A	INTRINSIC
C1	1362	1410	1.97e-9	SMART
PH	1443	1564	1.31e-8	SMART
CNH	1591	1888	1.78e-112	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000137952

SMART Domains

Protein: ENSMUSP00000122745
Gene: ENSMUSG00000029516

Domain	Start	End	E-Value	Type
Pfam:Pkinase	97	175	9.4e-10	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000141101
AA Change: A203V

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: A203V

Domain	Start	End	E-Value	Type
S_TKc	97	359	1.4e-91	SMART
S_TK_X	360	422	3e-18	SMART
low complexity region	632	646	N/A	INTRINSIC
low complexity region	686	698	N/A	INTRINSIC
low complexity region	849	863	N/A	INTRINSIC
low complexity region	873	906	N/A	INTRINSIC
low complexity region	908	926	N/A	INTRINSIC
low complexity region	1026	1039	N/A	INTRINSIC
low complexity region	1096	1114	N/A	INTRINSIC
low complexity region	1140	1161	N/A	INTRINSIC
internal_repeat_1	1201	1240	1.73e-5	PROSPERO
low complexity region	1311	1322	N/A	INTRINSIC
C1	1347	1395	9.7e-12	SMART
PH	1428	1549	6e-11	SMART
CNH	1576	1873	8.6e-115	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146387

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147330

Predicted Effect

probably benign
Transcript: ENSMUST00000148245

SMART Domains

Protein: ENSMUSP00000119769
Gene: ENSMUSG00000029516

Domain	Start	End	E-Value	Type
Pfam:Pkinase	97	181	7.6e-12	PFAM
Pfam:Pkinase_Tyr	97	181	9.5e-6	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201056

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 103 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930596D02Rik	A	T	14: 35,811,461		probably null	Het
Abcb4	T	A	5: 8,947,376	C952S	probably damaging	Het
Adamtsl2	A	G	2: 27,089,635	D272G	probably benign	Het
Aim2	G	A	1: 173,461,964	D158N	probably damaging	Het
Aldh3b1	C	T	19: 3,914,024	R426H	probably damaging	Het
Apoc2	A	G	7: 19,673,353	S28P	probably benign	Het
Arfgef3	G	A	10: 18,597,431	T1628I	probably benign	Het
Atp10a	G	A	7: 58,819,740		probably null	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Bmp8b	T	A	4: 123,121,899	D226E	probably benign	Het
Brsk2	T	C	7: 141,998,492	Y618H	probably damaging	Het
Casp12	T	A	9: 5,346,554	F27Y	probably damaging	Het
Casp8	T	A	1: 58,844,792	N439K	probably benign	Het
Ccdc175	T	A	12: 72,157,507	K253N	probably benign	Het
Cdc42bpa	A	G	1: 180,040,179	H193R	probably damaging	Het
Cdk17	T	C	10: 93,216,472	M105T	probably benign	Het
Cdon	C	A	9: 35,478,611	P854T	probably damaging	Het
Cep44	A	G	8: 56,544,152	M117T	possibly damaging	Het
Cep89	A	T	7: 35,435,530	E674D	probably damaging	Het
Clstn1	C	A	4: 149,629,300		probably null	Het
Col7a1	T	A	9: 108,958,147	D565E	unknown	Het
Cpb1	T	A	3: 20,262,474	Y304F	probably damaging	Het
Cps1	T	G	1: 67,172,802	Y710D	probably damaging	Het
Creb3l1	T	C	2: 91,987,053	T372A	possibly damaging	Het
Dars	A	G	1: 128,405,381	V102A	probably benign	Het
Dhx35	C	T	2: 158,817,415	T168I	possibly damaging	Het
Dnah5	T	C	15: 28,327,779	S2100P	probably benign	Het
Dst	T	C	1: 34,266,960		probably null	Het
Egflam	A	C	15: 7,253,523	L351R	possibly damaging	Het
Elp2	T	A	18: 24,626,156	D523E	probably benign	Het
Exo5	C	A	4: 120,921,684	G328V	probably damaging	Het
Fam208a	C	T	14: 27,461,750	T722I	probably benign	Het
Fut9	A	G	4: 25,620,811	M1T	probably null	Het
Galnt5	A	G	2: 58,024,625	N584S	possibly damaging	Het
Gbp3	T	C	3: 142,567,772	V360A	probably damaging	Het
Gdf6	G	A	4: 9,859,977	C353Y	probably damaging	Het
Gm13089	A	T	4: 143,698,503	D123E	probably benign	Het
Hace1	A	G	10: 45,648,869	T244A	probably damaging	Het
Hr	T	C	14: 70,559,657	I500T	probably benign	Het
Ifnl2	A	T	7: 28,509,282	L115Q	probably damaging	Het
Iigp1	T	C	18: 60,389,824	F5L	probably benign	Het
Inhbb	A	G	1: 119,417,416	L381P	probably damaging	Het
Irx3	A	T	8: 91,801,093	S50T	probably benign	Het
Ivns1abp	C	T	1: 151,360,145	T363I	probably benign	Het
Izumo1	A	T	7: 45,622,899	T35S	probably benign	Het
Kank4	A	G	4: 98,777,105	S651P	probably damaging	Het
Kit	T	C	5: 75,610,879	V232A	probably benign	Het
Klhl11	T	C	11: 100,463,714	Y427C	probably damaging	Het
Laptm4b	T	A	15: 34,258,689	N36K	probably damaging	Het
Lrrk1	T	C	7: 66,266,615		probably null	Het
Mamdc4	G	T	2: 25,564,193	Q1042K	probably benign	Het
Mical2	A	G	7: 112,321,440		probably null	Het
Ms4a3	C	A	19: 11,631,361	V176F	possibly damaging	Het
Myo3a	A	C	2: 22,396,299	E626D	possibly damaging	Het
Myo3a	T	C	2: 22,333,513	V427A	probably benign	Het
Nckap5	A	T	1: 126,027,288	L509*	probably null	Het
Ndufa5	A	T	6: 24,519,249	D64E	possibly damaging	Het
Nedd4l	T	C	18: 65,208,461	Y753H	probably damaging	Het
Nynrin	T	C	14: 55,872,761	V1775A	probably damaging	Het
Olfr141	A	G	2: 86,806,861	L46S	probably damaging	Het
Olfr292	T	C	7: 86,694,876	V140A	possibly damaging	Het
Olfr694	A	T	7: 106,688,998	H244Q	probably damaging	Het
Olfr735	T	C	14: 50,345,926	Y141C	probably damaging	Het
Olfr823	G	A	10: 130,112,580	S70F	probably damaging	Het
Oplah	A	G	15: 76,302,992	S570P	probably benign	Het
Osbpl11	C	A	16: 33,234,444	Y632*	probably null	Het
Osbpl5	A	T	7: 143,694,821	L644Q	probably damaging	Het
Pcdhb19	T	C	18: 37,497,952	W267R	probably benign	Het
Pkhd1l1	A	C	15: 44,467,424	S132R	possibly damaging	Het
Ptpn13	T	A	5: 103,556,145	S1348T	probably benign	Het
Rc3h1	T	A	1: 160,930,135	W8R	probably damaging	Het
Rgs3	T	G	4: 62,625,936	V315G	probably damaging	Het
Rora	T	A	9: 69,361,869	M82K	probably damaging	Het
Rph3al	T	C	11: 75,908,969	I55V	probably benign	Het
Sag	T	C	1: 87,812,991	V45A	probably damaging	Het
Scn3a	T	C	2: 65,536,510	E56G	probably damaging	Het
Sec24c	T	G	14: 20,686,948	V324G	probably damaging	Het
Sptbn1	A	G	11: 30,138,979	L748S	probably damaging	Het
Stard9	A	T	2: 120,706,306	D4186V	probably damaging	Het
Stk39	T	C	2: 68,366,167	E306G	probably damaging	Het
Sycp1	C	A	3: 102,898,849		probably null	Het
Taf2	A	C	15: 55,060,050	L277R	probably damaging	Het
Tbc1d23	T	A	16: 57,173,106	I566F	possibly damaging	Het
Tekt5	T	C	16: 10,361,304	T400A	possibly damaging	Het
Tgfbrap1	T	C	1: 43,060,141	H401R	probably benign	Het
Tie1	T	A	4: 118,476,147	I841L	possibly damaging	Het
Tln1	T	G	4: 43,544,645	T1095P	possibly damaging	Het
Tmem147	A	G	7: 30,728,102	Y72H	probably benign	Het
Tnfaip2	A	G	12: 111,453,507	N691S	probably benign	Het
Trim24	G	A	6: 37,957,783	C811Y	probably damaging	Het
Trim30b	T	A	7: 104,357,976		probably benign	Het
Trpc4	T	G	3: 54,194,768	L29R	probably damaging	Het
Trpm6	A	T	19: 18,825,862	I890F	probably damaging	Het
Ttc23l	C	T	15: 10,504,536	E442K	probably benign	Het
Uggt2	A	G	14: 119,095,336	V62A	probably damaging	Het
Ugt1a6a	C	A	1: 88,138,884	S137R	probably benign	Het
Unc13a	A	G	8: 71,658,467	Y367H	probably damaging	Het
Vmn2r49	A	G	7: 9,976,306	I833T	probably benign	Het
Vmn2r7	T	C	3: 64,716,479	D231G	probably benign	Het
Ythdc2	A	T	18: 44,864,357	M994L	probably benign	Het
Zcchc6	A	T	13: 59,799,782	C506*	probably null	Het
Zfp804a	G	A	2: 82,257,588	S587N	probably damaging	Het
Zswim2	A	G	2: 83,923,659	I219T	probably benign	Het

Other mutations in Cit

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00321:Cit	APN	5	115846465	missense	probably damaging	0.99
IGL00482:Cit	APN	5	115938755	missense	probably damaging	0.97
IGL01317:Cit	APN	5	115908716	missense	probably benign	0.03
IGL01335:Cit	APN	5	115908830	splice site	probably benign
IGL01415:Cit	APN	5	115941903	missense	possibly damaging	0.78
IGL01447:Cit	APN	5	115873843	splice site	probably benign
IGL01537:Cit	APN	5	115933854	missense	probably benign	0.00
IGL01621:Cit	APN	5	115992603	splice site	probably benign
IGL02010:Cit	APN	5	115875947	missense	probably damaging	1.00
IGL02538:Cit	APN	5	115986989	nonsense	probably null
IGL02607:Cit	APN	5	115859209	missense	probably benign
IGL02720:Cit	APN	5	115995452	missense	probably benign	0.26
IGL02725:Cit	APN	5	115985473	missense	probably benign	0.02
IGL02967:Cit	APN	5	115945837	missense	probably benign	0.11
IGL02973:Cit	APN	5	116005999	missense	possibly damaging	0.73
IGL03383:Cit	APN	5	115873845	splice site	probably benign
PIT4514001:Cit	UTSW	5	115997854	critical splice donor site	probably null
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0206:Cit	UTSW	5	115994030	missense	possibly damaging	0.72
R0226:Cit	UTSW	5	115984840	missense	probably damaging	0.99
R0320:Cit	UTSW	5	115979445	missense	possibly damaging	0.87
R0401:Cit	UTSW	5	115985479	missense	probably benign	0.06
R0480:Cit	UTSW	5	115933393	splice site	probably benign
R0737:Cit	UTSW	5	115946919	missense	probably damaging	1.00
R1238:Cit	UTSW	5	115851221	missense	probably benign	0.30
R1503:Cit	UTSW	5	115873900	missense	possibly damaging	0.94
R1551:Cit	UTSW	5	115945842	missense	probably benign	0.00
R1602:Cit	UTSW	5	115997730	missense	probably damaging	1.00
R1720:Cit	UTSW	5	115967897	missense	probably damaging	0.98
R1854:Cit	UTSW	5	115873901	missense	probably damaging	1.00
R1886:Cit	UTSW	5	115933486	missense	probably damaging	1.00
R2024:Cit	UTSW	5	115947924	missense	probably damaging	0.97
R2024:Cit	UTSW	5	116005840	missense	probably damaging	0.97
R2048:Cit	UTSW	5	115886813	splice site	probably null
R2128:Cit	UTSW	5	115985507	missense	possibly damaging	0.63
R2192:Cit	UTSW	5	115968009	missense	probably benign	0.00
R2244:Cit	UTSW	5	115926505	missense	probably damaging	1.00
R2518:Cit	UTSW	5	115987046	missense	probably damaging	0.99
R2679:Cit	UTSW	5	115969115	missense	probably benign	0.00
R2898:Cit	UTSW	5	115873978	splice site	probably null
R2908:Cit	UTSW	5	115981676	missense	probably benign	0.00
R3079:Cit	UTSW	5	115925486	missense	probably damaging	0.97
R3779:Cit	UTSW	5	115859341	missense	probably benign	0.01
R4081:Cit	UTSW	5	115948050	missense	probably damaging	1.00
R4494:Cit	UTSW	5	115873984	missense	probably damaging	1.00
R4610:Cit	UTSW	5	115994087	missense	probably benign	0.01
R4757:Cit	UTSW	5	115997549	missense	probably damaging	1.00
R4788:Cit	UTSW	5	115933506	missense	probably damaging	1.00
R4816:Cit	UTSW	5	115908691	missense	probably damaging	1.00
R4890:Cit	UTSW	5	115988123	intron	probably benign
R4899:Cit	UTSW	5	115863028	missense	possibly damaging	0.60
R4928:Cit	UTSW	5	115985797	missense	probably benign	0.00
R5073:Cit	UTSW	5	115946843	missense	probably benign	0.24
R5151:Cit	UTSW	5	115979835	missense	probably damaging	1.00
R5154:Cit	UTSW	5	115988405	missense	probably damaging	1.00
R5222:Cit	UTSW	5	115952543	missense	probably benign	0.03
R5814:Cit	UTSW	5	115979419	missense	probably damaging	1.00
R5935:Cit	UTSW	5	115925539	intron	probably benign
R5946:Cit	UTSW	5	115997534	missense	probably damaging	1.00
R6051:Cit	UTSW	5	115846405	missense	probably benign
R6289:Cit	UTSW	5	116006326	makesense	probably null
R6298:Cit	UTSW	5	115948065	missense	probably damaging	1.00
R6362:Cit	UTSW	5	115886676	missense	probably benign	0.01
R6545:Cit	UTSW	5	115846434	missense	probably null	0.00
R6761:Cit	UTSW	5	115908675	missense	probably damaging	1.00
R6798:Cit	UTSW	5	115926526	missense	possibly damaging	0.56
R6814:Cit	UTSW	5	115884963	missense	probably damaging	1.00
R6825:Cit	UTSW	5	115981774	missense	probably damaging	0.99
R6845:Cit	UTSW	5	115984888	missense	probably damaging	1.00
R6983:Cit	UTSW	5	115994091	missense	probably damaging	1.00
R7164:Cit	UTSW	5	115985787	missense	possibly damaging	0.94
R7359:Cit	UTSW	5	115926574	missense	probably damaging	1.00
R7597:Cit	UTSW	5	115886681	nonsense	probably null
R7729:Cit	UTSW	5	115984822	missense	possibly damaging	0.87
R7763:Cit	UTSW	5	115987001	missense	probably benign	0.01
R7786:Cit	UTSW	5	115863018	missense	probably benign	0.00
R7799:Cit	UTSW	5	115862968	missense	probably benign	0.00
R8060:Cit	UTSW	5	115908727	missense	probably benign	0.00
R8068:Cit	UTSW	5	115952466	missense	probably damaging	1.00
R8068:Cit	UTSW	5	115982235	missense	probably benign	0.03
R8122:Cit	UTSW	5	115969010	missense	probably damaging	1.00
R8177:Cit	UTSW	5	115988159	missense	probably benign	0.18
R8178:Cit	UTSW	5	115969072	missense	probably damaging	1.00
R8265:Cit	UTSW	5	115988177	missense	probably damaging	1.00
R8359:Cit	UTSW	5	115984544	splice site	probably null
R8397:Cit	UTSW	5	115886797	missense	probably benign
R8489:Cit	UTSW	5	115945903	critical splice donor site	probably null
R8784:Cit	UTSW	5	115846383	nonsense	probably null
R8798:Cit	UTSW	5	115969043	missense	probably damaging	0.99
R8882:Cit	UTSW	5	115863030	missense	probably benign	0.04
R8984:Cit	UTSW	5	115926475	missense	possibly damaging	0.86
R9091:Cit	UTSW	5	115846102	intron	probably benign
R9127:Cit	UTSW	5	115936837	nonsense	probably null
R9204:Cit	UTSW	5	115988439	missense	probably damaging	0.99
R9212:Cit	UTSW	5	115875893	missense	possibly damaging	0.75
R9279:Cit	UTSW	5	115927911	missense	probably damaging	1.00
R9288:Cit	UTSW	5	115985453	missense	probably damaging	1.00
R9377:Cit	UTSW	5	115946855	missense	probably benign	0.04
R9520:Cit	UTSW	5	115941895	nonsense	probably null
Z1088:Cit	UTSW	5	115985533	missense	possibly damaging	0.62
Z1176:Cit	UTSW	5	115986603	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCGTCTCGCACATGGACATTG -3'
(R):5'- CCGGCCATTTTGGAGAGTTGTCAG -3'

Sequencing Primer
(F):5'- ATGGACATTGCCTCGCAGAG -3'
(R):5'- TTGTCAGCCAATCACAGGGTG -3'

Posted On

2013-07-11