Mutagenetix > Incidental Mutation

Incidental Mutation 'R7013:Arid5b'

545133

Institutional Source

Beutler Lab

Gene Symbol

Arid5b

Ensembl Gene

ENSMUSG00000019947

Gene Name

AT rich interactive domain 5B (MRF1-like)

Synonyms

5430435G07Rik, Mrf2beta, Mrf2alpha, Mrf2, Desrt

MMRRC Submission

Accession Numbers

Genbank: NM_023598; MGI: 2175912

Essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R7013 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68092520-68278740 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68097819 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 508 (V508A)

Ref Sequence

ENSEMBL: ENSMUSP00000151665 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]

AlphaFold

Q8BM75

Predicted Effect

probably benign
Transcript: ENSMUST00000020106

SMART Domains

Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

Domain	Start	End	E-Value	Type
ARID	316	407	8.29e-35	SMART
BRIGHT	320	412	4.18e-38	SMART
low complexity region	425	438	N/A	INTRINSIC
low complexity region	451	462	N/A	INTRINSIC
low complexity region	538	549	N/A	INTRINSIC
low complexity region	695	718	N/A	INTRINSIC
low complexity region	730	741	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000218532
AA Change: V508A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000219238
AA Change: V751A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]

Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,641,386	I213V	probably null	Het
Abcc4	A	T	14: 118,526,343	C952S	probably benign	Het
Adhfe1	T	C	1: 9,550,591		probably benign	Het
Apob	T	A	12: 8,010,080	L2854*	probably null	Het
Arhgap5	T	A	12: 52,518,326	N693K	probably benign	Het
Atl1	A	G	12: 69,953,440	E288G	probably damaging	Het
Bank1	A	G	3: 136,100,509	S455P	possibly damaging	Het
Ces1c	A	T	8: 93,130,764	L63Q	probably damaging	Het
Crmp1	A	T	5: 37,268,692		probably null	Het
Csnka2ip	T	C	16: 64,478,417	D528G	unknown	Het
Dact2	T	C	17: 14,203,534	T66A	probably benign	Het
Dkk2	T	C	3: 132,174,999	L135P	probably damaging	Het
Drc3	A	G	11: 60,387,303	N381S	probably benign	Het
Dsg4	T	C	18: 20,458,521	V439A	possibly damaging	Het
Dysf	C	T	6: 84,137,358	P1240S	probably damaging	Het
Esyt1	A	T	10: 128,525,651	V58E	probably damaging	Het
Exo1	G	T	1: 175,893,772	A326S	probably damaging	Het
Fam20b	A	G	1: 156,690,565	S220P	probably damaging	Het
Fmo6	G	A	1: 162,918,248	T402I	probably benign	Het
Galnt10	A	T	11: 57,765,584	D198V	probably benign	Het
Gm17689	C	A	9: 36,582,558	W26C	unknown	Het
Gsap	A	T	5: 21,278,110	E604D	probably benign	Het
Il20rb	A	G	9: 100,461,428	Y258H	probably benign	Het
Impg1	A	T	9: 80,378,494	S409R	probably damaging	Het
Jak3	G	T	8: 71,678,781	V97F	possibly damaging	Het
Lbhd1	T	C	19: 8,884,159	S52P	probably damaging	Het
Lman2l	A	G	1: 36,443,518		probably benign	Het
Lnpep	C	A	17: 17,568,363	M493I	probably benign	Het
Mpp4	T	C	1: 59,149,615	D132G	probably damaging	Het
Nlrp1a	G	A	11: 71,123,552	R291W	probably benign	Het
Olfr1252	T	A	2: 89,721,386	I242F	probably benign	Het
Olfr1309	G	A	2: 111,983,963	A37V	probably benign	Het
Olfr142	C	T	2: 90,252,097	R297Q	possibly damaging	Het
Olfr382	G	T	11: 73,516,421	Y259*	probably null	Het
Olfr733	T	A	14: 50,299,199	I37F	probably damaging	Het
Orc5	A	G	5: 22,533,789	V158A	probably benign	Het
Pcdhga3	A	G	18: 37,675,621	N376D	probably damaging	Het
Ptprr	T	A	10: 116,236,754	I207N	probably damaging	Het
Recql5	A	G	11: 115,894,576	V698A	probably benign	Het
Rnf212	A	T	5: 108,729,960	M222K	probably benign	Het
Rsph6a	A	G	7: 19,054,895	S51G	probably benign	Het
Smap2	T	C	4: 120,982,168	K121E	probably damaging	Het
Syt11	A	T	3: 88,747,989	V335D	possibly damaging	Het
Terb1	A	T	8: 104,488,590	C251*	probably null	Het
Tmprss11d	C	A	5: 86,326,573	R37L	probably damaging	Het
Ttbk2	T	C	2: 120,745,784	N904S	possibly damaging	Het
Vmn1r119	T	A	7: 21,011,789	I223F	probably damaging	Het
Vmn1r66	T	C	7: 10,274,756	R117G	possibly damaging	Het
Zfp106	T	C	2: 120,531,632	D1025G	probably damaging	Het

Other mutations in Arid5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Arid5b	APN	10	68128975	missense	probably damaging	0.96
IGL01731:Arid5b	APN	10	68097609	missense	probably damaging	1.00
IGL02069:Arid5b	APN	10	68097399	missense	probably damaging	1.00
IGL02161:Arid5b	APN	10	68096668	missense	probably benign	0.00
IGL02555:Arid5b	APN	10	68101904	missense	probably benign	0.01
IGL02873:Arid5b	APN	10	68101950	missense	probably benign	0.06
IGL03119:Arid5b	APN	10	68243227	missense	probably damaging	1.00
IGL03271:Arid5b	APN	10	68097457	missense	possibly damaging	0.73
gobi	UTSW	10	68118345	missense	possibly damaging	0.92
3-1:Arid5b	UTSW	10	68098589	missense	probably damaging	1.00
PIT4677001:Arid5b	UTSW	10	68098011	missense	probably damaging	0.99
R0108:Arid5b	UTSW	10	68278729	utr 5 prime	probably benign
R0525:Arid5b	UTSW	10	68097846	missense	possibly damaging	0.90
R0533:Arid5b	UTSW	10	68186033	missense	probably damaging	1.00
R0646:Arid5b	UTSW	10	68096977	missense	probably damaging	1.00
R1066:Arid5b	UTSW	10	68098356	missense	probably benign	0.04
R1487:Arid5b	UTSW	10	68097214	nonsense	probably null
R1638:Arid5b	UTSW	10	68277947	missense	possibly damaging	0.48
R1789:Arid5b	UTSW	10	68186067	missense	probably damaging	0.99
R2031:Arid5b	UTSW	10	68278688	critical splice donor site	probably null
R2337:Arid5b	UTSW	10	68097777	missense	possibly damaging	0.63
R2996:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R2997:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R3547:Arid5b	UTSW	10	68098462	missense	probably benign	0.01
R4411:Arid5b	UTSW	10	68096689	missense	probably damaging	1.00
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R4860:Arid5b	UTSW	10	68243095	missense	probably damaging	0.97
R5219:Arid5b	UTSW	10	68278110	missense	probably benign	0.08
R5341:Arid5b	UTSW	10	68278127	missense	possibly damaging	0.87
R5434:Arid5b	UTSW	10	68096889	missense	possibly damaging	0.67
R5757:Arid5b	UTSW	10	68102079	missense	probably damaging	1.00
R6114:Arid5b	UTSW	10	68097744	missense	possibly damaging	0.89
R6313:Arid5b	UTSW	10	68097582	missense	possibly damaging	0.95
R6338:Arid5b	UTSW	10	68098561	nonsense	probably null
R6525:Arid5b	UTSW	10	68097666	missense	possibly damaging	0.47
R6915:Arid5b	UTSW	10	68186212	nonsense	probably null
R7099:Arid5b	UTSW	10	68098179	missense	probably damaging	1.00
R7260:Arid5b	UTSW	10	68097807	missense	probably damaging	1.00
R7324:Arid5b	UTSW	10	68128922	missense	probably benign	0.44
R7334:Arid5b	UTSW	10	68243177	missense	possibly damaging	0.61
R7432:Arid5b	UTSW	10	68118266	missense	probably damaging	1.00
R7453:Arid5b	UTSW	10	68243164	missense	probably benign	0.01
R7649:Arid5b	UTSW	10	68118345	missense	possibly damaging	0.92
R7659:Arid5b	UTSW	10	68098587	missense	probably benign
R7661:Arid5b	UTSW	10	68098587	missense	probably benign
R7662:Arid5b	UTSW	10	68098587	missense	probably benign
R7663:Arid5b	UTSW	10	68098587	missense	probably benign
R7665:Arid5b	UTSW	10	68098587	missense	probably benign
R7666:Arid5b	UTSW	10	68098587	missense	probably benign
R7759:Arid5b	UTSW	10	68097802	missense	probably damaging	1.00
R7779:Arid5b	UTSW	10	68096776	missense	probably damaging	1.00
R7788:Arid5b	UTSW	10	68098587	missense	probably benign
R7789:Arid5b	UTSW	10	68098587	missense	probably benign
R7875:Arid5b	UTSW	10	68128941	missense	probably benign	0.02
R8079:Arid5b	UTSW	10	68098356	missense	possibly damaging	0.88
R8096:Arid5b	UTSW	10	68186152	missense	probably benign	0.00
R8228:Arid5b	UTSW	10	68278706	missense	possibly damaging	0.95
R8377:Arid5b	UTSW	10	68097387	missense	probably damaging	0.96
R8757:Arid5b	UTSW	10	68097810	missense	probably damaging	1.00
R8910:Arid5b	UTSW	10	68098278	missense
R8954:Arid5b	UTSW	10	68101980	missense	possibly damaging	0.88
R9234:Arid5b	UTSW	10	68128798	missense	possibly damaging	0.82
R9272:Arid5b	UTSW	10	68102052	missense	probably damaging	0.99
R9430:Arid5b	UTSW	10	68186257	critical splice acceptor site	probably null
X0066:Arid5b	UTSW	10	68118302	missense	probably damaging	1.00
Z1177:Arid5b	UTSW	10	68097228	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GAGACGGCTCTCTTCTCTAACAG -3'
(R):5'- TCATGTCCCCATTGGCTAAG -3'

Sequencing Primer
(F):5'- AACAGTTTATCTTTGCCCTCCTGTG -3'
(R):5'- TGTCCCCATTGGCTAAGAAAAAG -3'

Posted On

2019-05-13