Incidental Mutation 'R7013:Arid5b'
ID 545133
Institutional Source Beutler Lab
Gene Symbol Arid5b
Ensembl Gene ENSMUSG00000019947
Gene Name AT-rich interaction domain 5B
Synonyms Mrf2alpha, Mrf2beta, Mrf2, 5430435G07Rik, Desrt
MMRRC Submission 045114-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.941) question?
Stock # R7013 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 67928350-68114570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 67933649 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 508 (V508A)
Ref Sequence ENSEMBL: ENSMUSP00000151665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020106] [ENSMUST00000218532] [ENSMUST00000219238]
AlphaFold Q8BM75
Predicted Effect probably benign
Transcript: ENSMUST00000020106
SMART Domains Protein: ENSMUSP00000020106
Gene: ENSMUSG00000019947

DomainStartEndE-ValueType
ARID 316 407 8.29e-35 SMART
BRIGHT 320 412 4.18e-38 SMART
low complexity region 425 438 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
low complexity region 695 718 N/A INTRINSIC
low complexity region 730 741 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218532
AA Change: V508A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000219238
AA Change: V751A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the AT-rich interaction domain (ARID) family of DNA binding proteins. The encoded protein forms a histone H3K9Me2 demethylase complex with PHD finger protein 2 and regulates the transcription of target genes involved in adipogenesis and liver development. This gene also plays a role in cell growth and differentiation of B-lymphocyte progenitors, and single nucleotide polymorphisms in this gene are associated with acute lymphoblastic leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene experience a high level of mortality perinatally or earlier. Growth rates are low and mice remain small throughout live. There are abnormalities in various organ systems as well as the reproductive system. Fertility is reduced. [provided by MGI curators]
Allele List at MGI

All alleles(212) : Targeted, knock-out(2) Gene trapped(210)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,618,345 (GRCm39) I213V probably null Het
Abcc4 A T 14: 118,763,755 (GRCm39) C952S probably benign Het
Adhfe1 T C 1: 9,620,816 (GRCm39) probably benign Het
Apob T A 12: 8,060,080 (GRCm39) L2854* probably null Het
Arhgap5 T A 12: 52,565,109 (GRCm39) N693K probably benign Het
Atl1 A G 12: 70,000,214 (GRCm39) E288G probably damaging Het
Bank1 A G 3: 135,806,270 (GRCm39) S455P possibly damaging Het
Ces1c A T 8: 93,857,392 (GRCm39) L63Q probably damaging Het
Crmp1 A T 5: 37,426,036 (GRCm39) probably null Het
Csnka2ip T C 16: 64,298,780 (GRCm39) D528G unknown Het
Dact2 T C 17: 14,423,796 (GRCm39) T66A probably benign Het
Dkk2 T C 3: 131,880,760 (GRCm39) L135P probably damaging Het
Drc3 A G 11: 60,278,129 (GRCm39) N381S probably benign Het
Dsg4 T C 18: 20,591,578 (GRCm39) V439A possibly damaging Het
Dysf C T 6: 84,114,340 (GRCm39) P1240S probably damaging Het
Esyt1 A T 10: 128,361,520 (GRCm39) V58E probably damaging Het
Exo1 G T 1: 175,721,338 (GRCm39) A326S probably damaging Het
Fam20b A G 1: 156,518,135 (GRCm39) S220P probably damaging Het
Fmo6 G A 1: 162,745,817 (GRCm39) T402I probably benign Het
Galnt10 A T 11: 57,656,410 (GRCm39) D198V probably benign Het
Gsap A T 5: 21,483,108 (GRCm39) E604D probably benign Het
Il20rb A G 9: 100,343,481 (GRCm39) Y258H probably benign Het
Impg1 A T 9: 80,285,776 (GRCm39) S409R probably damaging Het
Jak3 G T 8: 72,131,425 (GRCm39) V97F possibly damaging Het
Lbhd1 T C 19: 8,861,523 (GRCm39) S52P probably damaging Het
Lman2l A G 1: 36,482,599 (GRCm39) probably benign Het
Lnpep C A 17: 17,788,625 (GRCm39) M493I probably benign Het
Mpp4 T C 1: 59,188,774 (GRCm39) D132G probably damaging Het
Nlrp1a G A 11: 71,014,378 (GRCm39) R291W probably benign Het
Or1e23 G T 11: 73,407,247 (GRCm39) Y259* probably null Het
Or4a79 T A 2: 89,551,730 (GRCm39) I242F probably benign Het
Or4b13 C T 2: 90,082,441 (GRCm39) R297Q possibly damaging Het
Or4f15 G A 2: 111,814,308 (GRCm39) A37V probably benign Het
Or4n4b T A 14: 50,536,656 (GRCm39) I37F probably damaging Het
Orc5 A G 5: 22,738,787 (GRCm39) V158A probably benign Het
Pate8 C A 9: 36,493,854 (GRCm39) W26C unknown Het
Pcdhga3 A G 18: 37,808,674 (GRCm39) N376D probably damaging Het
Ptprr T A 10: 116,072,659 (GRCm39) I207N probably damaging Het
Recql5 A G 11: 115,785,402 (GRCm39) V698A probably benign Het
Rnf212 A T 5: 108,877,826 (GRCm39) M222K probably benign Het
Rsph6a A G 7: 18,788,820 (GRCm39) S51G probably benign Het
Smap2 T C 4: 120,839,365 (GRCm39) K121E probably damaging Het
Syt11 A T 3: 88,655,296 (GRCm39) V335D possibly damaging Het
Terb1 A T 8: 105,215,222 (GRCm39) C251* probably null Het
Tmprss11d C A 5: 86,474,432 (GRCm39) R37L probably damaging Het
Ttbk2 T C 2: 120,576,265 (GRCm39) N904S possibly damaging Het
Vmn1r119 T A 7: 20,745,714 (GRCm39) I223F probably damaging Het
Vmn1r66 T C 7: 10,008,683 (GRCm39) R117G possibly damaging Het
Zfp106 T C 2: 120,362,113 (GRCm39) D1025G probably damaging Het
Other mutations in Arid5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Arid5b APN 10 67,964,805 (GRCm39) missense probably damaging 0.96
IGL01731:Arid5b APN 10 67,933,439 (GRCm39) missense probably damaging 1.00
IGL02069:Arid5b APN 10 67,933,229 (GRCm39) missense probably damaging 1.00
IGL02161:Arid5b APN 10 67,932,498 (GRCm39) missense probably benign 0.00
IGL02555:Arid5b APN 10 67,937,734 (GRCm39) missense probably benign 0.01
IGL02873:Arid5b APN 10 67,937,780 (GRCm39) missense probably benign 0.06
IGL03119:Arid5b APN 10 68,079,057 (GRCm39) missense probably damaging 1.00
IGL03271:Arid5b APN 10 67,933,287 (GRCm39) missense possibly damaging 0.73
gobi UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
3-1:Arid5b UTSW 10 67,934,419 (GRCm39) missense probably damaging 1.00
PIT4677001:Arid5b UTSW 10 67,933,841 (GRCm39) missense probably damaging 0.99
R0108:Arid5b UTSW 10 68,114,559 (GRCm39) utr 5 prime probably benign
R0525:Arid5b UTSW 10 67,933,676 (GRCm39) missense possibly damaging 0.90
R0533:Arid5b UTSW 10 68,021,863 (GRCm39) missense probably damaging 1.00
R0646:Arid5b UTSW 10 67,932,807 (GRCm39) missense probably damaging 1.00
R1066:Arid5b UTSW 10 67,934,186 (GRCm39) missense probably benign 0.04
R1487:Arid5b UTSW 10 67,933,044 (GRCm39) nonsense probably null
R1638:Arid5b UTSW 10 68,113,777 (GRCm39) missense possibly damaging 0.48
R1789:Arid5b UTSW 10 68,021,897 (GRCm39) missense probably damaging 0.99
R2031:Arid5b UTSW 10 68,114,518 (GRCm39) critical splice donor site probably null
R2337:Arid5b UTSW 10 67,933,607 (GRCm39) missense possibly damaging 0.63
R2996:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R2997:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R3547:Arid5b UTSW 10 67,934,292 (GRCm39) missense probably benign 0.01
R4411:Arid5b UTSW 10 67,932,519 (GRCm39) missense probably damaging 1.00
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R4860:Arid5b UTSW 10 68,078,925 (GRCm39) missense probably damaging 0.97
R5219:Arid5b UTSW 10 68,113,940 (GRCm39) missense probably benign 0.08
R5341:Arid5b UTSW 10 68,113,957 (GRCm39) missense possibly damaging 0.87
R5434:Arid5b UTSW 10 67,932,719 (GRCm39) missense possibly damaging 0.67
R5757:Arid5b UTSW 10 67,937,909 (GRCm39) missense probably damaging 1.00
R6114:Arid5b UTSW 10 67,933,574 (GRCm39) missense possibly damaging 0.89
R6313:Arid5b UTSW 10 67,933,412 (GRCm39) missense possibly damaging 0.95
R6338:Arid5b UTSW 10 67,934,391 (GRCm39) nonsense probably null
R6525:Arid5b UTSW 10 67,933,496 (GRCm39) missense possibly damaging 0.47
R6915:Arid5b UTSW 10 68,022,042 (GRCm39) nonsense probably null
R7099:Arid5b UTSW 10 67,934,009 (GRCm39) missense probably damaging 1.00
R7260:Arid5b UTSW 10 67,933,637 (GRCm39) missense probably damaging 1.00
R7324:Arid5b UTSW 10 67,964,752 (GRCm39) missense probably benign 0.44
R7334:Arid5b UTSW 10 68,079,007 (GRCm39) missense possibly damaging 0.61
R7432:Arid5b UTSW 10 67,954,096 (GRCm39) missense probably damaging 1.00
R7453:Arid5b UTSW 10 68,078,994 (GRCm39) missense probably benign 0.01
R7649:Arid5b UTSW 10 67,954,175 (GRCm39) missense possibly damaging 0.92
R7659:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7661:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7662:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7663:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7665:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7666:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7759:Arid5b UTSW 10 67,933,632 (GRCm39) missense probably damaging 1.00
R7779:Arid5b UTSW 10 67,932,606 (GRCm39) missense probably damaging 1.00
R7788:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7789:Arid5b UTSW 10 67,934,417 (GRCm39) missense probably benign
R7875:Arid5b UTSW 10 67,964,771 (GRCm39) missense probably benign 0.02
R8079:Arid5b UTSW 10 67,934,186 (GRCm39) missense possibly damaging 0.88
R8096:Arid5b UTSW 10 68,021,982 (GRCm39) missense probably benign 0.00
R8228:Arid5b UTSW 10 68,114,536 (GRCm39) missense possibly damaging 0.95
R8377:Arid5b UTSW 10 67,933,217 (GRCm39) missense probably damaging 0.96
R8757:Arid5b UTSW 10 67,933,640 (GRCm39) missense probably damaging 1.00
R8910:Arid5b UTSW 10 67,934,108 (GRCm39) missense
R8954:Arid5b UTSW 10 67,937,810 (GRCm39) missense possibly damaging 0.88
R9234:Arid5b UTSW 10 67,964,628 (GRCm39) missense possibly damaging 0.82
R9272:Arid5b UTSW 10 67,937,882 (GRCm39) missense probably damaging 0.99
R9430:Arid5b UTSW 10 68,022,087 (GRCm39) critical splice acceptor site probably null
X0066:Arid5b UTSW 10 67,954,132 (GRCm39) missense probably damaging 1.00
Z1177:Arid5b UTSW 10 67,933,058 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGACGGCTCTCTTCTCTAACAG -3'
(R):5'- TCATGTCCCCATTGGCTAAG -3'

Sequencing Primer
(F):5'- AACAGTTTATCTTTGCCCTCCTGTG -3'
(R):5'- TGTCCCCATTGGCTAAGAAAAAG -3'
Posted On 2019-05-13