Mutagenetix > Incidental Mutation

Incidental Mutation 'R7013:Atl1'

545143

Institutional Source

Beutler Lab

Gene Symbol

Atl1

Ensembl Gene

ENSMUSG00000021066

Gene Name

atlastin GTPase 1

Synonyms

AD-FSP, Spg3a, FSP1, SPG3

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.398) question?

Stock #

R7013 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

69892614-69966417 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69953440 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 288 (E288G)

Ref Sequence

ENSEMBL: ENSMUSP00000021466 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021466]

AlphaFold

Q8BH66

Predicted Effect

probably damaging
Transcript: ENSMUST00000021466
AA Change: E288G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000021466
Gene: ENSMUSG00000021066
AA Change: E288G

Domain	Start	End	E-Value	Type
low complexity region	15	27	N/A	INTRINSIC
Pfam:GBP	43	314	2.3e-103	PFAM
low complexity region	350	363	N/A	INTRINSIC
Blast:HAMP	468	519	9e-8	BLAST

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (47/47)

MGI Phenotype

FUNCTION: This gene encodes a member of the dynamin family of GTPases. The encoded protein interacts with tubule-shaping proteins of the endoplasmic reticulum. Mutations in the homologous human gene can cause hereditary spastic paraplegia. [provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous animals show a gait disturbance characterized by external rotation of the hind feet with footprint analysis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	G	6: 121,641,386	I213V	probably null	Het
Abcc4	A	T	14: 118,526,343	C952S	probably benign	Het
Adhfe1	T	C	1: 9,550,591		probably benign	Het
Apob	T	A	12: 8,010,080	L2854*	probably null	Het
Arhgap5	T	A	12: 52,518,326	N693K	probably benign	Het
Arid5b	A	G	10: 68,097,819	V508A	probably damaging	Het
Bank1	A	G	3: 136,100,509	S455P	possibly damaging	Het
Ces1c	A	T	8: 93,130,764	L63Q	probably damaging	Het
Crmp1	A	T	5: 37,268,692		probably null	Het
Csnka2ip	T	C	16: 64,478,417	D528G	unknown	Het
Dact2	T	C	17: 14,203,534	T66A	probably benign	Het
Dkk2	T	C	3: 132,174,999	L135P	probably damaging	Het
Drc3	A	G	11: 60,387,303	N381S	probably benign	Het
Dsg4	T	C	18: 20,458,521	V439A	possibly damaging	Het
Dysf	C	T	6: 84,137,358	P1240S	probably damaging	Het
Esyt1	A	T	10: 128,525,651	V58E	probably damaging	Het
Exo1	G	T	1: 175,893,772	A326S	probably damaging	Het
Fam20b	A	G	1: 156,690,565	S220P	probably damaging	Het
Fmo6	G	A	1: 162,918,248	T402I	probably benign	Het
Galnt10	A	T	11: 57,765,584	D198V	probably benign	Het
Gm17689	C	A	9: 36,582,558	W26C	unknown	Het
Gsap	A	T	5: 21,278,110	E604D	probably benign	Het
Il20rb	A	G	9: 100,461,428	Y258H	probably benign	Het
Impg1	A	T	9: 80,378,494	S409R	probably damaging	Het
Jak3	G	T	8: 71,678,781	V97F	possibly damaging	Het
Lbhd1	T	C	19: 8,884,159	S52P	probably damaging	Het
Lman2l	A	G	1: 36,443,518		probably benign	Het
Lnpep	C	A	17: 17,568,363	M493I	probably benign	Het
Mpp4	T	C	1: 59,149,615	D132G	probably damaging	Het
Nlrp1a	G	A	11: 71,123,552	R291W	probably benign	Het
Olfr1252	T	A	2: 89,721,386	I242F	probably benign	Het
Olfr1309	G	A	2: 111,983,963	A37V	probably benign	Het
Olfr142	C	T	2: 90,252,097	R297Q	possibly damaging	Het
Olfr382	G	T	11: 73,516,421	Y259*	probably null	Het
Olfr733	T	A	14: 50,299,199	I37F	probably damaging	Het
Orc5	A	G	5: 22,533,789	V158A	probably benign	Het
Pcdhga3	A	G	18: 37,675,621	N376D	probably damaging	Het
Ptprr	T	A	10: 116,236,754	I207N	probably damaging	Het
Recql5	A	G	11: 115,894,576	V698A	probably benign	Het
Rnf212	A	T	5: 108,729,960	M222K	probably benign	Het
Rsph6a	A	G	7: 19,054,895	S51G	probably benign	Het
Smap2	T	C	4: 120,982,168	K121E	probably damaging	Het
Syt11	A	T	3: 88,747,989	V335D	possibly damaging	Het
Terb1	A	T	8: 104,488,590	C251*	probably null	Het
Tmprss11d	C	A	5: 86,326,573	R37L	probably damaging	Het
Ttbk2	T	C	2: 120,745,784	N904S	possibly damaging	Het
Vmn1r119	T	A	7: 21,011,789	I223F	probably damaging	Het
Vmn1r66	T	C	7: 10,274,756	R117G	possibly damaging	Het
Zfp106	T	C	2: 120,531,632	D1025G	probably damaging	Het

Other mutations in Atl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00824:Atl1	APN	12	69932238	missense	probably damaging	0.99
IGL02035:Atl1	APN	12	69960544	unclassified	probably benign
IGL02229:Atl1	APN	12	69926025	missense	probably benign	0.01
IGL03282:Atl1	APN	12	69954464	missense	possibly damaging	0.87
IGL03374:Atl1	APN	12	69955367	missense	probably damaging	1.00
R1538:Atl1	UTSW	12	69926188	missense	probably benign	0.02
R1819:Atl1	UTSW	12	69963300	missense	probably benign
R1903:Atl1	UTSW	12	69959275	missense	probably damaging	0.98
R1961:Atl1	UTSW	12	69953500	missense	probably benign	0.00
R1990:Atl1	UTSW	12	69963328	missense	probably damaging	1.00
R2126:Atl1	UTSW	12	69931657	splice site	probably null
R3724:Atl1	UTSW	12	69959380	missense	probably damaging	0.99
R4402:Atl1	UTSW	12	69959199	missense	probably benign	0.09
R5241:Atl1	UTSW	12	69959113	missense	possibly damaging	0.52
R5256:Atl1	UTSW	12	69959333	missense	probably damaging	1.00
R5285:Atl1	UTSW	12	69954499	missense	probably benign	0.18
R5866:Atl1	UTSW	12	69926011	missense	probably damaging	0.98
R6001:Atl1	UTSW	12	69932283	missense	possibly damaging	0.92
R6434:Atl1	UTSW	12	69959425	nonsense	probably null
R6677:Atl1	UTSW	12	69953444	missense	probably damaging	0.99
R6728:Atl1	UTSW	12	69947550	missense	possibly damaging	0.95
R6974:Atl1	UTSW	12	69926039	missense	probably damaging	0.99
R7121:Atl1	UTSW	12	69931634	missense	probably damaging	0.99
R7224:Atl1	UTSW	12	69955353	missense	probably benign
R7437:Atl1	UTSW	12	69931622	missense	probably benign	0.37
R8043:Atl1	UTSW	12	69959215	missense	probably damaging	1.00
R8319:Atl1	UTSW	12	69955319	missense	probably damaging	0.99
R8843:Atl1	UTSW	12	69926148	missense	probably damaging	0.98
Z1176:Atl1	UTSW	12	69937075	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AGCCATGAATTACCTGCCC -3'
(R):5'- ATGTGAGGGGAAGTGCTCAC -3'

Sequencing Primer
(F):5'- GAGTTAGTTCAAAGCCAGCCTTG -3'
(R):5'- TGAGGGGAAGTGCTCACAAGAG -3'

Posted On

2019-05-13