Incidental Mutation 'R7013:Lnpep'
ID545148
Institutional Source Beutler Lab
Gene Symbol Lnpep
Ensembl Gene ENSMUSG00000023845
Gene Nameleucyl/cystinyl aminopeptidase
Synonymsgp160, 4732490P18Rik, 2010309L07Rik, IRAP, vp165
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7013 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location17521410-17625050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 17568363 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 493 (M493I)
Ref Sequence ENSEMBL: ENSMUSP00000036998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041047]
Predicted Effect probably benign
Transcript: ENSMUST00000041047
AA Change: M493I

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000036998
Gene: ENSMUSG00000023845
AA Change: M493I

DomainStartEndE-ValueType
low complexity region 60 71 N/A INTRINSIC
transmembrane domain 110 132 N/A INTRINSIC
Pfam:Peptidase_M1 167 552 9.2e-143 PFAM
Pfam:ERAP1_C 689 1007 1e-60 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (47/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc-dependent aminopeptidase that cleaves vasopressin, oxytocin, lys-bradykinin, met-enkephalin, dynorphin A and other peptide hormones. The protein can be secreted in maternal serum, reside in intracellular vesicles with the insulin-responsive glucose transporter GLUT4, or form a type II integral membrane glycoprotein. The protein catalyzes the final step in the conversion of angiotensinogen to angiotensin IV (AT4) and is also a receptor for AT4. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a somewhat reduced tissue uptake of glucose either basally or after insulin stimulation. Mice homozygous for a different knock-out allele exhibit impaired coordination at 3 months and impaired spatial working memory in a Y maze at 6 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A G 6: 121,641,386 I213V probably null Het
Abcc4 A T 14: 118,526,343 C952S probably benign Het
Adhfe1 T C 1: 9,550,591 probably benign Het
Apob T A 12: 8,010,080 L2854* probably null Het
Arhgap5 T A 12: 52,518,326 N693K probably benign Het
Arid5b A G 10: 68,097,819 V508A probably damaging Het
Atl1 A G 12: 69,953,440 E288G probably damaging Het
Bank1 A G 3: 136,100,509 S455P possibly damaging Het
Ces1c A T 8: 93,130,764 L63Q probably damaging Het
Crmp1 A T 5: 37,268,692 probably null Het
Csnka2ip T C 16: 64,478,417 D528G unknown Het
Dact2 T C 17: 14,203,534 T66A probably benign Het
Dkk2 T C 3: 132,174,999 L135P probably damaging Het
Drc3 A G 11: 60,387,303 N381S probably benign Het
Dsg4 T C 18: 20,458,521 V439A possibly damaging Het
Dysf C T 6: 84,137,358 P1240S probably damaging Het
Esyt1 A T 10: 128,525,651 V58E probably damaging Het
Exo1 G T 1: 175,893,772 A326S probably damaging Het
Fam20b A G 1: 156,690,565 S220P probably damaging Het
Fmo6 G A 1: 162,918,248 T402I probably benign Het
Galnt10 A T 11: 57,765,584 D198V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gsap A T 5: 21,278,110 E604D probably benign Het
Il20rb A G 9: 100,461,428 Y258H probably benign Het
Impg1 A T 9: 80,378,494 S409R probably damaging Het
Jak3 G T 8: 71,678,781 V97F possibly damaging Het
Lbhd1 T C 19: 8,884,159 S52P probably damaging Het
Lman2l A G 1: 36,443,518 probably benign Het
Mpp4 T C 1: 59,149,615 D132G probably damaging Het
Nlrp1a G A 11: 71,123,552 R291W probably benign Het
Olfr1252 T A 2: 89,721,386 I242F probably benign Het
Olfr1309 G A 2: 111,983,963 A37V probably benign Het
Olfr142 C T 2: 90,252,097 R297Q possibly damaging Het
Olfr382 G T 11: 73,516,421 Y259* probably null Het
Olfr733 T A 14: 50,299,199 I37F probably damaging Het
Orc5 A G 5: 22,533,789 V158A probably benign Het
Pcdhga3 A G 18: 37,675,621 N376D probably damaging Het
Ptprr T A 10: 116,236,754 I207N probably damaging Het
Recql5 A G 11: 115,894,576 V698A probably benign Het
Rnf212 A T 5: 108,729,960 M222K probably benign Het
Rsph6a A G 7: 19,054,895 S51G probably benign Het
Smap2 T C 4: 120,982,168 K121E probably damaging Het
Syt11 A T 3: 88,747,989 V335D possibly damaging Het
Terb1 A T 8: 104,488,590 C251* probably null Het
Tmprss11d C A 5: 86,326,573 R37L probably damaging Het
Ttbk2 T C 2: 120,745,784 N904S possibly damaging Het
Vmn1r119 T A 7: 21,011,789 I223F probably damaging Het
Vmn1r66 T C 7: 10,274,756 R117G possibly damaging Het
Zfp106 T C 2: 120,531,632 D1025G probably damaging Het
Other mutations in Lnpep
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01983:Lnpep APN 17 17531178 missense probably damaging 1.00
IGL02008:Lnpep APN 17 17570957 missense probably benign 0.40
IGL02040:Lnpep APN 17 17544905 missense probably benign 0.13
IGL02392:Lnpep APN 17 17579183 missense possibly damaging 0.48
IGL02417:Lnpep APN 17 17544903 missense possibly damaging 0.57
IGL02659:Lnpep APN 17 17570900 missense possibly damaging 0.83
IGL02697:Lnpep APN 17 17553193 missense probably benign
IGL02947:Lnpep APN 17 17570972 missense probably damaging 1.00
IGL03493:Lnpep APN 17 17579171 missense probably damaging 1.00
I0000:Lnpep UTSW 17 17578971 missense probably damaging 1.00
PIT4504001:Lnpep UTSW 17 17579027 missense probably benign 0.00
R0528:Lnpep UTSW 17 17531132 splice site probably benign
R0535:Lnpep UTSW 17 17571673 missense possibly damaging 0.91
R0540:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R0586:Lnpep UTSW 17 17575396 splice site probably benign
R0607:Lnpep UTSW 17 17538554 missense probably damaging 1.00
R1502:Lnpep UTSW 17 17571644 missense probably damaging 1.00
R1570:Lnpep UTSW 17 17579156 missense probably damaging 1.00
R1733:Lnpep UTSW 17 17553313 missense probably benign 0.00
R1826:Lnpep UTSW 17 17562836 missense probably damaging 1.00
R2015:Lnpep UTSW 17 17579063 missense probably damaging 0.99
R2029:Lnpep UTSW 17 17568399 missense probably damaging 1.00
R4593:Lnpep UTSW 17 17579027 missense probably benign 0.00
R4638:Lnpep UTSW 17 17575307 missense probably damaging 1.00
R4741:Lnpep UTSW 17 17571658 missense probably damaging 1.00
R4919:Lnpep UTSW 17 17578911 missense probably damaging 1.00
R5030:Lnpep UTSW 17 17579309 missense probably damaging 1.00
R5111:Lnpep UTSW 17 17578610 missense possibly damaging 0.93
R5203:Lnpep UTSW 17 17537063 missense probably damaging 1.00
R5320:Lnpep UTSW 17 17546465 missense possibly damaging 0.83
R5419:Lnpep UTSW 17 17566730 missense probably damaging 1.00
R5535:Lnpep UTSW 17 17538694 missense probably benign 0.02
R5680:Lnpep UTSW 17 17579182 nonsense probably null
R6134:Lnpep UTSW 17 17553192 missense probably benign
R6142:Lnpep UTSW 17 17566681 critical splice donor site probably null
R6189:Lnpep UTSW 17 17566739 missense possibly damaging 0.46
R6225:Lnpep UTSW 17 17578983 missense possibly damaging 0.66
R6350:Lnpep UTSW 17 17562809 missense probably benign 0.01
R6357:Lnpep UTSW 17 17552914 missense probably benign 0.00
R6765:Lnpep UTSW 17 17530496 missense probably damaging 1.00
R6794:Lnpep UTSW 17 17531159 missense probably damaging 1.00
R7208:Lnpep UTSW 17 17552910 nonsense probably null
R7268:Lnpep UTSW 17 17538541 missense probably benign
R7564:Lnpep UTSW 17 17578592 missense probably benign 0.22
R7746:Lnpep UTSW 17 17538562 missense probably benign
R7853:Lnpep UTSW 17 17562847 missense probably benign 0.00
R7881:Lnpep UTSW 17 17566739 missense probably benign 0.01
R7936:Lnpep UTSW 17 17562847 missense probably benign 0.00
R7964:Lnpep UTSW 17 17566739 missense probably benign 0.01
R8015:Lnpep UTSW 17 17546499 missense not run
R8070:Lnpep UTSW 17 17538638 missense not run
X0004:Lnpep UTSW 17 17544812 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATTGTCAAGTCTCCAGCATTAC -3'
(R):5'- GGAGTTTCACTTTAATGAAGCAGC -3'

Sequencing Primer
(F):5'- TCCCTCCTCATAGGACAAAG -3'
(R):5'- GGATTTCTGAGTTCGAAACCAGCC -3'
Posted On2019-05-13