Incidental Mutation 'R7014:Scn7a'
ID545156
Institutional Source Beutler Lab
Gene Symbol Scn7a
Ensembl Gene ENSMUSG00000034810
Gene Namesodium channel, voltage-gated, type VII, alpha
SynonymsNaG, Nav2, Nav2.3, Nax, Scn6a
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location66673425-66784914 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 66741959 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 223 (G223C)
Ref Sequence ENSEMBL: ENSMUSP00000042405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042792]
Predicted Effect probably null
Transcript: ENSMUST00000042792
AA Change: G223C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042405
Gene: ENSMUSG00000034810
AA Change: G223C

DomainStartEndE-ValueType
Pfam:Ion_trans 118 405 4.7e-53 PFAM
coiled coil region 415 443 N/A INTRINSIC
Pfam:Ion_trans 505 739 5.8e-36 PFAM
Pfam:Na_trans_assoc 741 929 4.1e-17 PFAM
Pfam:Ion_trans 933 1204 3e-49 PFAM
Pfam:Ion_trans 1250 1505 5e-37 PFAM
IQ 1624 1646 6.4e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the many voltage-gated sodium channel proteins. For proper functioning of neurons and muscles during action potentials, voltage-gated sodium channels direct sodium ion diffusion for membrane depolarization. This sodium channel protein has some atypical characteristics; the similarity between the human and mouse proteins is lower compared to other orthologous sodium channel pairs. Also, the S4 segments, which sense voltage changes, have fewer positive charged residues that in other sodium channels; domain 4 has fewer arginine and lysine residues compared to other sodium channel proteins. Several alternatively spliced transcript variants exist, but the full-length natures of all of them remain unknown. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene have a modified dietary preference for NaCl but are phenotypically normal otherwise. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Scn7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Scn7a APN 2 66683327 splice site probably benign
IGL00432:Scn7a APN 2 66741982 nonsense probably null
IGL00720:Scn7a APN 2 66676044 missense possibly damaging 0.67
IGL00783:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00784:Scn7a APN 2 66692564 missense probably damaging 0.99
IGL00926:Scn7a APN 2 66684131 missense probably benign 0.06
IGL00963:Scn7a APN 2 66703945 splice site probably benign
IGL01099:Scn7a APN 2 66684238 missense probably damaging 1.00
IGL01326:Scn7a APN 2 66752260 missense probably benign 0.13
IGL01538:Scn7a APN 2 66703852 missense probably benign
IGL01624:Scn7a APN 2 66751925 missense probably benign 0.07
IGL01794:Scn7a APN 2 66675509 missense probably benign
IGL02100:Scn7a APN 2 66675499 makesense probably null
IGL02326:Scn7a APN 2 66700048 missense probably benign 0.00
IGL02472:Scn7a APN 2 66752314 missense probably damaging 1.00
IGL02528:Scn7a APN 2 66700175 missense probably damaging 1.00
IGL02798:Scn7a APN 2 66713875 missense probably benign 0.00
IGL03026:Scn7a APN 2 66676098 missense probably damaging 0.99
IGL03071:Scn7a APN 2 66699947 missense possibly damaging 0.89
IGL03080:Scn7a APN 2 66697816 missense probably benign 0.01
IGL03180:Scn7a APN 2 66676234 missense possibly damaging 0.94
IGL03337:Scn7a APN 2 66675960 missense probably benign 0.00
PIT4514001:Scn7a UTSW 2 66684179 missense probably damaging 1.00
R0004:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R0076:Scn7a UTSW 2 66714037 missense probably benign 0.04
R0230:Scn7a UTSW 2 66726284 missense probably damaging 1.00
R0463:Scn7a UTSW 2 66675740 missense probably benign 0.05
R0846:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1237:Scn7a UTSW 2 66680295 missense probably damaging 0.98
R1282:Scn7a UTSW 2 66700849 missense probably damaging 0.98
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1467:Scn7a UTSW 2 66689558 missense probably benign 0.01
R1501:Scn7a UTSW 2 66700163 missense probably benign 0.37
R1672:Scn7a UTSW 2 66697600 missense possibly damaging 0.71
R1690:Scn7a UTSW 2 66675943 missense probably damaging 0.99
R1712:Scn7a UTSW 2 66705103 missense probably benign 0.05
R1758:Scn7a UTSW 2 66680183 missense probably benign 0.00
R1758:Scn7a UTSW 2 66700887 missense probably damaging 0.97
R1775:Scn7a UTSW 2 66680955 missense probably benign 0.02
R1848:Scn7a UTSW 2 66684013 critical splice donor site probably null
R1851:Scn7a UTSW 2 66680291 missense probably benign
R1919:Scn7a UTSW 2 66699973 missense probably damaging 1.00
R1932:Scn7a UTSW 2 66676102 missense probably damaging 1.00
R1945:Scn7a UTSW 2 66675980 missense probably damaging 1.00
R1970:Scn7a UTSW 2 66684289 missense possibly damaging 0.89
R1998:Scn7a UTSW 2 66683269 missense probably damaging 0.99
R2008:Scn7a UTSW 2 66687747 missense possibly damaging 0.82
R2038:Scn7a UTSW 2 66737436 missense probably damaging 1.00
R2113:Scn7a UTSW 2 66675968 missense probably damaging 1.00
R2128:Scn7a UTSW 2 66697986 missense probably damaging 0.99
R2163:Scn7a UTSW 2 66675956 missense probably damaging 0.97
R2421:Scn7a UTSW 2 66726302 splice site probably benign
R2446:Scn7a UTSW 2 66692658 missense probably damaging 0.98
R2922:Scn7a UTSW 2 66700207 splice site probably benign
R3015:Scn7a UTSW 2 66699896 missense probably benign 0.08
R3034:Scn7a UTSW 2 66682808 missense probably damaging 1.00
R3419:Scn7a UTSW 2 66700895 frame shift probably null
R3429:Scn7a UTSW 2 66700895 frame shift probably null
R3430:Scn7a UTSW 2 66700895 frame shift probably null
R3434:Scn7a UTSW 2 66675503 missense probably benign 0.01
R3803:Scn7a UTSW 2 66680246 nonsense probably null
R3831:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R3833:Scn7a UTSW 2 66697684 missense probably damaging 0.96
R4017:Scn7a UTSW 2 66741985 missense probably damaging 1.00
R4244:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4245:Scn7a UTSW 2 66742001 missense probably benign 0.00
R4276:Scn7a UTSW 2 66684063 missense probably damaging 0.97
R4307:Scn7a UTSW 2 66675755 missense possibly damaging 0.47
R4327:Scn7a UTSW 2 66737471 missense probably damaging 1.00
R4353:Scn7a UTSW 2 66676436 missense probably benign 0.00
R4721:Scn7a UTSW 2 66684185 missense probably damaging 1.00
R4722:Scn7a UTSW 2 66700884 missense possibly damaging 0.95
R4781:Scn7a UTSW 2 66703760 missense possibly damaging 0.95
R4792:Scn7a UTSW 2 66726248 missense probably damaging 1.00
R5362:Scn7a UTSW 2 66699998 missense probably damaging 1.00
R5437:Scn7a UTSW 2 66676346 missense probably damaging 1.00
R5729:Scn7a UTSW 2 66741957 critical splice donor site probably null
R5777:Scn7a UTSW 2 66692569 missense probably damaging 1.00
R5785:Scn7a UTSW 2 66697568 missense possibly damaging 0.79
R5821:Scn7a UTSW 2 66743703 missense probably damaging 0.96
R5830:Scn7a UTSW 2 66714051 nonsense probably null
R5877:Scn7a UTSW 2 66699873 nonsense probably null
R5881:Scn7a UTSW 2 66675526 missense probably benign 0.01
R5967:Scn7a UTSW 2 66675713 missense probably damaging 1.00
R5988:Scn7a UTSW 2 66726214 nonsense probably null
R6077:Scn7a UTSW 2 66697596 missense probably damaging 1.00
R6135:Scn7a UTSW 2 66703900 missense probably benign
R6242:Scn7a UTSW 2 66700766 missense probably benign 0.00
R6264:Scn7a UTSW 2 66675526 missense possibly damaging 0.93
R6291:Scn7a UTSW 2 66700114 missense probably damaging 0.98
R6544:Scn7a UTSW 2 66684100 missense probably damaging 1.00
R6770:Scn7a UTSW 2 66729184 intron probably null
R6997:Scn7a UTSW 2 66703803 missense probably damaging 1.00
R7126:Scn7a UTSW 2 66757286 missense possibly damaging 0.80
R7129:Scn7a UTSW 2 66700193 missense probably benign 0.14
R7176:Scn7a UTSW 2 66676288 missense probably damaging 1.00
R7185:Scn7a UTSW 2 66687795 missense possibly damaging 0.81
R7276:Scn7a UTSW 2 66757162 missense probably damaging 1.00
R7332:Scn7a UTSW 2 66692554 nonsense probably null
R7421:Scn7a UTSW 2 66675532 missense probably benign 0.07
R7488:Scn7a UTSW 2 66757230 missense probably benign 0.16
X0060:Scn7a UTSW 2 66689682 missense probably benign 0.01
X0066:Scn7a UTSW 2 66680192 missense probably benign
Z1088:Scn7a UTSW 2 66713951 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAACTGGTTTCTTGGTGAAAGGAG -3'
(R):5'- TCTAGAGTGGAATCATGGGAGC -3'

Sequencing Primer
(F):5'- AGAATCTATCTCTGCTATCCATTGAG -3'
(R):5'- TCATGGGAGCAAGGAATATCC -3'
Posted On2019-05-13