Incidental Mutation 'R7014:Pde4dip'
ID545164
Institutional Source Beutler Lab
Gene Symbol Pde4dip
Ensembl Gene ENSMUSG00000038170
Gene Namephosphodiesterase 4D interacting protein (myomegalin)
SynonymsD130016K21Rik, Usmg4, 4732458A06Rik, D3Bwg1078e, 9430063L05Rik
MMRRC Submission
Accession Numbers

Genbank:NM_001039376.2, NM_001110163.1, NM_178080.4, NM_177145.3; MGI: 1891434; Ensembl: ENSMUST00000045243, ENSMUST00000090750, ENSMUST00000107038, ENSMUST00000163531, ENSMUST00000168438

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97689824-97888707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97715422 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 1490 (N1490K)
Ref Sequence ENSEMBL: ENSMUSP00000088254 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090750] [ENSMUST00000168438]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090750
AA Change: N1490K

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000088254
Gene: ENSMUSG00000038170
AA Change: N1490K

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Cnn_1N 124 196 3.2e-26 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 4.03e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 6.59e-5 PROSPERO
internal_repeat_1 620 661 4.03e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 6.59e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1780 N/A INTRINSIC
low complexity region 1836 1851 N/A INTRINSIC
low complexity region 1860 1874 N/A INTRINSIC
low complexity region 1940 1951 N/A INTRINSIC
coiled coil region 1962 2138 N/A INTRINSIC
coiled coil region 2162 2197 N/A INTRINSIC
coiled coil region 2387 2431 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168438
AA Change: N1490K

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131170
Gene: ENSMUSG00000038170
AA Change: N1490K

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
low complexity region 45 57 N/A INTRINSIC
Pfam:Microtub_assoc 124 198 1.4e-31 PFAM
low complexity region 204 219 N/A INTRINSIC
coiled coil region 282 325 N/A INTRINSIC
internal_repeat_1 397 438 3.56e-5 PROSPERO
low complexity region 567 578 N/A INTRINSIC
internal_repeat_2 617 667 5.83e-5 PROSPERO
internal_repeat_1 620 661 3.56e-5 PROSPERO
coiled coil region 866 942 N/A INTRINSIC
low complexity region 1038 1056 N/A INTRINSIC
low complexity region 1067 1082 N/A INTRINSIC
coiled coil region 1118 1163 N/A INTRINSIC
coiled coil region 1336 1363 N/A INTRINSIC
low complexity region 1403 1420 N/A INTRINSIC
coiled coil region 1470 1508 N/A INTRINSIC
internal_repeat_2 1597 1644 5.83e-5 PROSPERO
DUF1220 1680 1747 1.17e-17 SMART
low complexity region 1758 1769 N/A INTRINSIC
low complexity region 1785 1800 N/A INTRINSIC
low complexity region 1809 1823 N/A INTRINSIC
low complexity region 1889 1900 N/A INTRINSIC
coiled coil region 1911 2087 N/A INTRINSIC
coiled coil region 2111 2146 N/A INTRINSIC
coiled coil region 2336 2380 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit partial (in utero or perinatal) lethality, hyperactivity, and increased vertical activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Pde4dip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Pde4dip APN 3 97767277 missense probably benign 0.00
IGL00543:Pde4dip APN 3 97757624 missense possibly damaging 0.91
IGL00979:Pde4dip APN 3 97747758 splice site probably benign
IGL01483:Pde4dip APN 3 97754149 missense probably damaging 1.00
IGL02122:Pde4dip APN 3 97767421 missense probably damaging 1.00
IGL02398:Pde4dip APN 3 97766781 missense probably benign
IGL02814:Pde4dip APN 3 97767100 missense probably damaging 1.00
IGL02826:Pde4dip APN 3 97767087 missense probably damaging 1.00
D3080:Pde4dip UTSW 3 97766830 missense probably damaging 1.00
R0077:Pde4dip UTSW 3 97753126 nonsense probably null
R0096:Pde4dip UTSW 3 97767467 missense probably damaging 0.99
R0277:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0304:Pde4dip UTSW 3 97843712 missense probably benign 0.01
R0616:Pde4dip UTSW 3 97747533 missense probably benign 0.09
R0676:Pde4dip UTSW 3 97717097 splice site probably benign
R1166:Pde4dip UTSW 3 97713196 missense possibly damaging 0.94
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1376:Pde4dip UTSW 3 97743217 missense probably damaging 0.99
R1452:Pde4dip UTSW 3 97724102 missense probably damaging 1.00
R1550:Pde4dip UTSW 3 97719704 missense probably damaging 1.00
R1700:Pde4dip UTSW 3 97703323 missense probably benign 0.00
R1704:Pde4dip UTSW 3 97754260 missense probably benign 0.28
R1769:Pde4dip UTSW 3 97695930 missense probably benign 0.00
R1934:Pde4dip UTSW 3 97692691 missense possibly damaging 0.74
R1980:Pde4dip UTSW 3 97756996 missense possibly damaging 0.93
R2088:Pde4dip UTSW 3 97754433 missense probably null 1.00
R2143:Pde4dip UTSW 3 97888519 missense possibly damaging 0.86
R2149:Pde4dip UTSW 3 97792836 missense possibly damaging 0.64
R2156:Pde4dip UTSW 3 97724218 missense probably damaging 0.98
R2158:Pde4dip UTSW 3 97757621 missense probably benign 0.15
R2240:Pde4dip UTSW 3 97724164 missense probably benign 0.00
R2249:Pde4dip UTSW 3 97793525 missense probably damaging 1.00
R2256:Pde4dip UTSW 3 97718184 missense probably damaging 1.00
R2680:Pde4dip UTSW 3 97701617 missense possibly damaging 0.92
R2921:Pde4dip UTSW 3 97719569 missense probably benign
R3407:Pde4dip UTSW 3 97754468 missense probably damaging 1.00
R3736:Pde4dip UTSW 3 97724111 missense probably damaging 1.00
R3787:Pde4dip UTSW 3 97715552 missense possibly damaging 0.80
R3883:Pde4dip UTSW 3 97713188 missense probably damaging 1.00
R4437:Pde4dip UTSW 3 97766569 missense possibly damaging 0.52
R4528:Pde4dip UTSW 3 97717022 missense probably damaging 1.00
R4576:Pde4dip UTSW 3 97754249 missense probably damaging 1.00
R4600:Pde4dip UTSW 3 97695944 missense probably damaging 0.98
R4653:Pde4dip UTSW 3 97767338 missense probably damaging 0.99
R4678:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4679:Pde4dip UTSW 3 97695005 missense probably damaging 1.00
R4688:Pde4dip UTSW 3 97843677 nonsense probably null
R4770:Pde4dip UTSW 3 97767084 missense probably damaging 1.00
R4841:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4842:Pde4dip UTSW 3 97793528 missense probably damaging 1.00
R4899:Pde4dip UTSW 3 97709558 missense probably damaging 1.00
R4914:Pde4dip UTSW 3 97715328 missense probably benign 0.10
R4943:Pde4dip UTSW 3 97755511 missense probably damaging 0.99
R5131:Pde4dip UTSW 3 97709514 missense probably damaging 0.98
R5408:Pde4dip UTSW 3 97796736 missense probably benign 0.35
R5583:Pde4dip UTSW 3 97747576 missense possibly damaging 0.67
R5677:Pde4dip UTSW 3 97841648 nonsense probably null
R5689:Pde4dip UTSW 3 97692367 nonsense probably null
R5696:Pde4dip UTSW 3 97709490 missense probably damaging 1.00
R5860:Pde4dip UTSW 3 97724188 missense possibly damaging 0.68
R6279:Pde4dip UTSW 3 97699180 missense probably damaging 1.00
R6341:Pde4dip UTSW 3 97694911 missense probably benign
R6440:Pde4dip UTSW 3 97767586 missense probably damaging 1.00
R6464:Pde4dip UTSW 3 97710344 missense probably damaging 1.00
R6489:Pde4dip UTSW 3 97755591 nonsense probably null
R6706:Pde4dip UTSW 3 97741393 missense probably damaging 1.00
R6722:Pde4dip UTSW 3 97718239 nonsense probably null
R6798:Pde4dip UTSW 3 97888534 missense probably benign
R6804:Pde4dip UTSW 3 97793248 nonsense probably null
R6862:Pde4dip UTSW 3 97767024 missense possibly damaging 0.52
R6957:Pde4dip UTSW 3 97824333 splice site probably null
R6983:Pde4dip UTSW 3 97718236 missense probably damaging 1.00
R7025:Pde4dip UTSW 3 97724183 nonsense probably null
R7136:Pde4dip UTSW 3 97694063 missense probably benign 0.03
R7178:Pde4dip UTSW 3 97715630 missense probably benign 0.26
R7269:Pde4dip UTSW 3 97766959 missense probably damaging 1.00
R7283:Pde4dip UTSW 3 97758882 missense probably benign 0.03
R7354:Pde4dip UTSW 3 97719330 missense probably damaging 0.99
R7357:Pde4dip UTSW 3 97715541 missense probably benign 0.01
R7360:Pde4dip UTSW 3 97718316 missense probably benign 0.01
R7371:Pde4dip UTSW 3 97757271 missense probably benign 0.08
R7432:Pde4dip UTSW 3 97695092 missense probably benign
R7536:Pde4dip UTSW 3 97757244 missense probably damaging 1.00
R7542:Pde4dip UTSW 3 97766655 missense possibly damaging 0.59
R7609:Pde4dip UTSW 3 97715565 missense possibly damaging 0.85
R7650:Pde4dip UTSW 3 97699107 critical splice donor site probably null
R7800:Pde4dip UTSW 3 97715283 missense probably damaging 1.00
R7846:Pde4dip UTSW 3 97715174 missense probably damaging 1.00
R7918:Pde4dip UTSW 3 97715223 nonsense probably null
R8120:Pde4dip UTSW 3 97706938 missense probably null 0.94
R8139:Pde4dip UTSW 3 97696993 missense probably benign 0.02
R8144:Pde4dip UTSW 3 97715426 missense probably damaging 1.00
R8177:Pde4dip UTSW 3 97767532 missense probably damaging 0.98
R8294:Pde4dip UTSW 3 97767378 missense probably damaging 1.00
R8406:Pde4dip UTSW 3 97699112 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAAAGCCCCAGTGCCATCTG -3'
(R):5'- TGTCTCTTTCAGAGTGTGAGGAAC -3'

Sequencing Primer
(F):5'- GTGCCATCTGACAGCCAC -3'
(R):5'- ACAATAACCTGAGGCCCGTGG -3'
Posted On2019-05-13