Incidental Mutation 'R7014:Klhdc10'
ID545178
Institutional Source Beutler Lab
Gene Symbol Klhdc10
Ensembl Gene ENSMUSG00000029775
Gene Namekelch domain containing 10
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.308) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location30401868-30455179 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30450503 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 294 (I294N)
Ref Sequence ENSEMBL: ENSMUSP00000143839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068240] [ENSMUST00000068259] [ENSMUST00000123494] [ENSMUST00000132581] [ENSMUST00000144272]
Predicted Effect probably damaging
Transcript: ENSMUST00000068240
AA Change: I347N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000064594
Gene: ENSMUSG00000029775
AA Change: I347N

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 56 107 3.6e-7 PFAM
Pfam:Kelch_1 59 114 5.6e-8 PFAM
Pfam:Kelch_4 59 120 1.8e-7 PFAM
Pfam:Kelch_6 59 120 2.1e-8 PFAM
Pfam:Kelch_4 173 222 9.8e-9 PFAM
Pfam:Kelch_6 173 225 3.9e-9 PFAM
Pfam:Kelch_2 174 218 1.2e-7 PFAM
Pfam:Kelch_1 174 219 9.4e-8 PFAM
Kelch 239 294 4.93e0 SMART
Kelch 295 342 9.96e-4 SMART
low complexity region 373 384 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068259
AA Change: I376N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069669
Gene: ENSMUSG00000029775
AA Change: I376N

DomainStartEndE-ValueType
low complexity region 11 35 N/A INTRINSIC
Pfam:Kelch_5 85 135 1.2e-7 PFAM
Pfam:Kelch_1 88 143 2.6e-8 PFAM
Pfam:Kelch_4 88 149 1.5e-6 PFAM
Pfam:Kelch_6 88 150 3.1e-8 PFAM
Pfam:Kelch_6 202 255 4.6e-9 PFAM
Pfam:Kelch_2 203 247 1.4e-7 PFAM
Pfam:Kelch_1 203 248 2.6e-6 PFAM
Kelch 268 323 4.93e0 SMART
Kelch 324 371 9.96e-4 SMART
low complexity region 402 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123494
SMART Domains Protein: ENSMUSP00000145442
Gene: ENSMUSG00000029775

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 1.2e-4 PFAM
Pfam:Kelch_6 62 115 5.2e-8 PFAM
Pfam:Kelch_2 63 107 1.6e-6 PFAM
Pfam:Kelch_1 63 108 3.1e-5 PFAM
Pfam:Kelch_1 116 157 2.1e-6 PFAM
Pfam:Kelch_6 116 157 8.8e-6 PFAM
Pfam:Kelch_4 122 157 3.7e-4 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132581
AA Change: I294N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143839
Gene: ENSMUSG00000029775
AA Change: I294N

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
Pfam:Kelch_2 121 165 1.1e-6 PFAM
Pfam:Kelch_6 121 173 2.4e-8 PFAM
Pfam:Kelch_1 123 166 2.1e-5 PFAM
Pfam:Kelch_4 123 168 9.8e-5 PFAM
Kelch 186 241 1.7e-2 SMART
Kelch 242 289 3.3e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144272
AA Change: I236N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000145063
Gene: ENSMUSG00000029775
AA Change: I236N

DomainStartEndE-ValueType
Pfam:Kelch_4 62 110 3.5e-4 PFAM
Pfam:Kelch_6 62 115 1.6e-7 PFAM
Pfam:Kelch_2 63 107 4.8e-6 PFAM
Pfam:Kelch_1 63 108 9.1e-5 PFAM
Kelch 128 183 1.7e-2 SMART
Kelch 184 231 3.3e-6 SMART
low complexity region 262 273 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Klhdc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01743:Klhdc10 APN 6 30441934 splice site probably null
IGL02313:Klhdc10 APN 6 30439866 critical splice donor site probably null
IGL03353:Klhdc10 APN 6 30447992 splice site probably benign
PIT4378001:Klhdc10 UTSW 6 30447412 missense probably damaging 0.98
R0379:Klhdc10 UTSW 6 30450670 missense possibly damaging 0.89
R0390:Klhdc10 UTSW 6 30447412 missense probably damaging 0.98
R1199:Klhdc10 UTSW 6 30449494 missense probably damaging 1.00
R1628:Klhdc10 UTSW 6 30444462 missense probably damaging 0.98
R2243:Klhdc10 UTSW 6 30449559 missense probably damaging 1.00
R2861:Klhdc10 UTSW 6 30402140 missense unknown
R5007:Klhdc10 UTSW 6 30450641 missense probably benign 0.05
R5574:Klhdc10 UTSW 6 30439865 missense possibly damaging 0.92
R6428:Klhdc10 UTSW 6 30439856 missense probably damaging 1.00
R6724:Klhdc10 UTSW 6 30446641 missense probably damaging 0.99
R6842:Klhdc10 UTSW 6 30439782 missense probably damaging 1.00
R6879:Klhdc10 UTSW 6 30449590 missense probably damaging 1.00
R7124:Klhdc10 UTSW 6 30441827 missense probably damaging 1.00
R7453:Klhdc10 UTSW 6 30447990 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATACGAACAGTCTTGGTTTCCAC -3'
(R):5'- TGTGTGAGTCCAAGGTGCAG -3'

Sequencing Primer
(F):5'- TCCACGTAGGTTTAGATCAGTGAGAC -3'
(R):5'- TCCAAGGTGCAGGAGCTGTG -3'
Posted On2019-05-13