Mutagenetix > Incidental Mutations

Incidental Mutation 'R7014:Itpr1'

545182

Institutional Source

Beutler Lab

Gene Symbol

Itpr1

Ensembl Gene

ENSMUSG00000030102

Gene Name

inositol 1,4,5-trisphosphate receptor 1

Synonyms

P400, Itpr-1, IP3R1, Pcp1, Pcp-1, Ip3r, InsP3R type I, opt

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_010585.5; MGI: 96623

Is this an essential gene?

Probably essential (E-score: 0.803) question?

Stock #

R7014 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108213096-108551109 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to A at 108431498 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000144880 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032192] [ENSMUST00000203262] [ENSMUST00000203615]

Predicted Effect

probably null
Transcript: ENSMUST00000032192

SMART Domains

Protein: ENSMUSP00000032192
Gene: ENSMUSG00000030102

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1758	1787	N/A	INTRINSIC
Pfam:RIH_assoc	1959	2069	1.2e-33	PFAM
transmembrane domain	2274	2296	N/A	INTRINSIC
Pfam:Ion_trans	2311	2600	9e-22	PFAM
coiled coil region	2683	2732	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000203262

SMART Domains

Protein: ENSMUSP00000145177
Gene: ENSMUSG00000030102

Domain	Start	End	E-Value	Type
low complexity region	144	173	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000203615

SMART Domains

Protein: ENSMUSP00000144880
Gene: ENSMUSG00000030102

Domain	Start	End	E-Value	Type
MIR	112	166	7.99e-8	SMART
MIR	173	223	1.02e-5	SMART
MIR	231	287	2.33e-9	SMART
MIR	294	403	5.95e-16	SMART
Pfam:RYDR_ITPR	474	670	2.3e-61	PFAM
low complexity region	683	695	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	1004	1020	N/A	INTRINSIC
Pfam:RYDR_ITPR	1183	1344	1.9e-14	PFAM
low complexity region	1757	1786	N/A	INTRINSIC
Pfam:RIH_assoc	1958	2068	1.2e-33	PFAM
transmembrane domain	2273	2295	N/A	INTRINSIC
Pfam:Ion_trans	2310	2599	9e-22	PFAM
coiled coil region	2682	2731	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203638

Predicted Effect

probably benign
Transcript: ENSMUST00000203687

Meta Mutation Damage Score

0.9483

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.2%

Validation Efficiency

99% (80/81)

MGI Phenotype

Strain: 2180360; 3715928; 1856981
Lethality: D10-D21
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intracellular receptor for inositol 1,4,5-trisphosphate. Upon stimulation by inositol 1,4,5-trisphosphate, this receptor mediates calcium release from the endoplasmic reticulum. Mutations in this gene cause spinocerebellar ataxia type 15, a disease associated with an heterogeneous group of cerebellar disorders. Multiple transcript variants have been identified for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Most homozygotes for a targeted null mutation die in utero, while survivors exhibit severe ataxia, seizures, and lethality by weaning age. Homozygotes for a spontaneous mutation exhibit a postnatal phenotype similar to that of knockout mutants. [provided by MGI curators]

Allele List at MGI

All alleles(71) : Targeted(2) Gene trapped(67) Spontaneous(2)

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310022A10Rik	C	T	7: 27,578,773	Q156*	probably null	Het
2700097O09Rik	A	G	12: 55,045,942	I264T	probably benign	Het
Arid3a	G	T	10: 79,950,884	M488I	possibly damaging	Het
Auts2	A	G	5: 131,466,123	F331S	probably damaging	Het
Axdnd1	T	C	1: 156,330,962		probably null	Het
Bpifb5	C	A	2: 154,224,956	S43*	probably null	Het
Carhsp1	A	G	16: 8,661,005	V128A	probably benign	Het
Ccdc141	A	G	2: 77,132,297	V101A	probably damaging	Het
Cdk6	C	G	5: 3,473,152	L191V	probably damaging	Het
Cgnl1	T	G	9: 71,725,134	K312Q	possibly damaging	Het
Col6a1	T	C	10: 76,721,443	E225G	probably damaging	Het
Copg1	T	A	6: 87,902,340	L456Q	probably damaging	Het
Ctif	T	A	18: 75,437,208	D540V	possibly damaging	Het
Cyfip1	T	C	7: 55,919,493	I917T	probably benign	Het
Cyth1	T	C	11: 118,212,651	D9G	probably benign	Het
Dnajb1	T	C	8: 83,610,255	I118T	probably damaging	Het
Ebna1bp2	T	A	4: 118,623,378	Y139*	probably null	Het
Fam162a	A	T	16: 36,049,932	V59E	probably damaging	Het
Fam213a	T	C	14: 41,002,494	E71G	probably benign	Het
Fhad1	CGG	CG	4: 141,918,291		probably null	Het
Fmo6	C	G	1: 162,926,308	R112T	probably benign	Het
Gm11639	A	G	11: 104,693,422	T100A	probably benign	Het
Gm17087	T	A	17: 8,566,472	D133V	probably benign	Het
Gm17689	C	A	9: 36,582,558	W26C	unknown	Het
Gm21994	A	T	2: 150,255,262	C82*	probably null	Het
Gm42669	A	G	5: 107,508,276	I802V	probably benign	Het
Gp2	T	C	7: 119,451,645	N288D	probably damaging	Het
Gstm7	C	T	3: 107,926,962	D196N	probably benign	Het
Hsph1	A	T	5: 149,630,400	V201D	probably damaging	Het
Il20ra	T	C	10: 19,712,710	L26P	unknown	Het
Kcns3	A	T	12: 11,091,687	I337N	probably damaging	Het
Kdm4d	A	G	9: 14,464,179	Y128H	probably damaging	Het
Kirrel2	A	G	7: 30,454,574	I200T	probably benign	Het
Klhdc10	T	A	6: 30,450,503	I294N	probably damaging	Het
Map1a	A	C	2: 121,300,239	N512T	probably damaging	Het
March8	C	G	6: 116,403,543	C118W	probably damaging	Het
March8	T	G	6: 116,403,544	C119G	probably damaging	Het
Mrpl38	G	T	11: 116,134,915	P195Q	probably damaging	Het
Ms4a4d	A	T	19: 11,548,583	Q27L	probably benign	Het
Muc16	T	A	9: 18,658,236	T996S	unknown	Het
Mug1	C	T	6: 121,861,125	A438V	probably benign	Het
Mup7	T	A	4: 60,069,866	I33F	probably damaging	Het
Ndufa5	C	T	6: 24,519,191		probably null	Het
Olfr1133	A	T	2: 87,645,976	L49Q	probably damaging	Het
Olfr1141	T	C	2: 87,753,871	I41V	probably benign	Het
Olfr1535	A	G	13: 21,555,938	F28S	probably benign	Het
Olfr167	A	T	16: 19,515,456	F60Y	probably benign	Het
Olfr873	T	A	9: 20,300,663	C154*	probably null	Het
Parp9	T	A	16: 35,960,063		probably null	Het
Pbx1	T	A	1: 168,431,380	D42V	probably damaging	Het
Pde4dip	G	T	3: 97,715,422	N1490K	possibly damaging	Het
Pdzd2	T	C	15: 12,372,561	N2496S	probably benign	Het
Pdzd2	A	G	15: 12,372,975	M2358T	probably benign	Het
Pglyrp2	C	A	17: 32,415,930	C486F	probably damaging	Het
Pi4ka	A	G	16: 17,297,067		probably benign	Het
Pknox2	T	A	9: 36,909,667	T300S	probably damaging	Het
Plekhm3	A	G	1: 64,883,270	I582T	probably damaging	Het
Prtg	T	C	9: 72,891,985	Y766H	possibly damaging	Het
Rabgap1	A	G	2: 37,560,563	E901G	probably benign	Het
Rabgap1l	A	T	1: 160,342,072	N60K	probably damaging	Het
Rnf150	C	T	8: 83,042,663	T359I	probably benign	Het
Rps6ka2	C	T	17: 7,255,932	H236Y	probably benign	Het
Rrp1b	T	A	17: 32,049,427	L120Q	probably damaging	Het
Scn7a	C	A	2: 66,741,959	G223C	probably null	Het
Sema6a	T	A	18: 47,298,217	N138I	probably damaging	Het
Sept5	T	A	16: 18,624,909	I97F	probably damaging	Het
Shcbp1	T	A	8: 4,754,234	E225D	probably damaging	Het
Slc25a19	A	G	11: 115,620,966	C124R	probably damaging	Het
Slc37a2	C	T	9: 37,233,887	A428T	probably damaging	Het
Slc5a12	A	G	2: 110,644,364	I538V	probably benign	Het
Slco4c1	A	T	1: 96,823,781		probably null	Het
Smarcad1	T	C	6: 65,052,670	S81P	probably damaging	Het
Smyd1	T	C	6: 71,238,627	D116G	probably damaging	Het
Themis	T	C	10: 28,789,707	Y589H	probably benign	Het
Trim30d	T	C	7: 104,483,336	K248R	probably benign	Het
Tspan12	C	T	6: 21,772,919	M210I	probably benign	Het
Vmn2r11	T	C	5: 109,053,423	Y405C	probably damaging	Het
Wdfy3	A	G	5: 101,894,909		probably null	Het
Wiz	C	A	17: 32,361,866	A83S	probably damaging	Het
Zmym6	T	A	4: 127,123,544	Y947*	probably null	Het

Other mutations in Itpr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Itpr1	APN	6	108471120	missense	probably damaging	0.98
IGL01073:Itpr1	APN	6	108413820	missense	probably benign	0.00
IGL01105:Itpr1	APN	6	108381333	missense	probably benign	0.00
IGL01296:Itpr1	APN	6	108399361	missense	probably damaging	1.00
IGL01325:Itpr1	APN	6	108381208	missense	probably benign	0.01
IGL01418:Itpr1	APN	6	108339624	critical splice donor site	probably null
IGL01464:Itpr1	APN	6	108386727	missense	possibly damaging	0.95
IGL01467:Itpr1	APN	6	108488496	missense	probably damaging	0.96
IGL01645:Itpr1	APN	6	108473599	missense	possibly damaging	0.91
IGL01672:Itpr1	APN	6	108381032	nonsense	probably null
IGL01969:Itpr1	APN	6	108377691	missense	probably damaging	1.00
IGL02164:Itpr1	APN	6	108389483	missense	probably benign	0.08
IGL02206:Itpr1	APN	6	108549820	missense	probably damaging	1.00
IGL02232:Itpr1	APN	6	108417923	missense	probably damaging	1.00
IGL02297:Itpr1	APN	6	108339517	missense	possibly damaging	0.84
IGL02434:Itpr1	APN	6	108489922	splice site	probably null
IGL02568:Itpr1	APN	6	108339554	missense	possibly damaging	0.82
IGL02992:Itpr1	APN	6	108381315	missense	probably damaging	1.00
IGL03109:Itpr1	APN	6	108417981	missense	probably damaging	1.00
IGL03130:Itpr1	APN	6	108523401	missense	probably benign	0.00
IGL03333:Itpr1	APN	6	108380910	unclassified	probably benign
aboriginal	UTSW	6	108515947	missense	probably benign
approximation	UTSW	6	108394841	missense	probably benign
estimate	UTSW	6	108389553	missense	probably null	1.00
icarus	UTSW	6	108410900	missense	probably damaging	1.00
primordial	UTSW	6	108518755	missense	probably benign	0.06
roo	UTSW	6	108410867	missense	probably benign	0.00
wallaby	UTSW	6	108389387	missense	probably damaging	1.00
P0005:Itpr1	UTSW	6	108381257	missense	probably damaging	1.00
PIT4366001:Itpr1	UTSW	6	108493757	nonsense	probably null
R0019:Itpr1	UTSW	6	108354626	missense	probably damaging	1.00
R0128:Itpr1	UTSW	6	108471209	splice site	probably benign
R0129:Itpr1	UTSW	6	108349676	missense	probably damaging	1.00
R0135:Itpr1	UTSW	6	108488482	splice site	probably benign
R0244:Itpr1	UTSW	6	108473589	missense	probably benign	0.00
R0391:Itpr1	UTSW	6	108378167	missense	probably benign	0.22
R0543:Itpr1	UTSW	6	108515748	splice site	probably benign
R0647:Itpr1	UTSW	6	108383698	missense	probably damaging	1.00
R0766:Itpr1	UTSW	6	108410900	missense	probably damaging	1.00
R0971:Itpr1	UTSW	6	108349629	missense	possibly damaging	0.70
R1083:Itpr1	UTSW	6	108510696	missense	possibly damaging	0.92
R1277:Itpr1	UTSW	6	108339621	missense	probably benign	0.22
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1403:Itpr1	UTSW	6	108389553	missense	probably null	1.00
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1404:Itpr1	UTSW	6	108386648	missense	probably benign	0.04
R1605:Itpr1	UTSW	6	108349659	missense	possibly damaging	0.77
R1661:Itpr1	UTSW	6	108482897	missense	probably benign	0.38
R1852:Itpr1	UTSW	6	108386706	missense	probably damaging	1.00
R1929:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2012:Itpr1	UTSW	6	108440536	missense	probably benign	0.02
R2027:Itpr1	UTSW	6	108386853	missense	possibly damaging	0.80
R2111:Itpr1	UTSW	6	108378309	unclassified	probably benign
R2166:Itpr1	UTSW	6	108388225	missense	probably damaging	1.00
R2272:Itpr1	UTSW	6	108493755	missense	probably damaging	1.00
R2484:Itpr1	UTSW	6	108369110	missense	probably damaging	1.00
R3115:Itpr1	UTSW	6	108406109	missense	possibly damaging	0.55
R3751:Itpr1	UTSW	6	108349680	missense	probably damaging	1.00
R3798:Itpr1	UTSW	6	108381270	missense	probably damaging	1.00
R3930:Itpr1	UTSW	6	108394841	missense	probably benign
R4081:Itpr1	UTSW	6	108391835	missense	probably damaging	1.00
R4119:Itpr1	UTSW	6	108394355	missense	probably benign
R4406:Itpr1	UTSW	6	108354663	missense	probably damaging	1.00
R4506:Itpr1	UTSW	6	108432686	missense	probably damaging	1.00
R4616:Itpr1	UTSW	6	108481223	missense	probably damaging	1.00
R4655:Itpr1	UTSW	6	108481293	missense	probably damaging	1.00
R4661:Itpr1	UTSW	6	108410931	critical splice donor site	probably null
R4760:Itpr1	UTSW	6	108349632	missense	probably benign	0.29
R4836:Itpr1	UTSW	6	108389537	missense	probably damaging	0.99
R4857:Itpr1	UTSW	6	108410867	missense	probably benign	0.00
R4876:Itpr1	UTSW	6	108482906	missense	probably damaging	0.97
R4939:Itpr1	UTSW	6	108440558	nonsense	probably null
R5076:Itpr1	UTSW	6	108405529	splice site	probably null
R5088:Itpr1	UTSW	6	108389387	missense	probably damaging	1.00
R5248:Itpr1	UTSW	6	108542062	missense	probably damaging	1.00
R5290:Itpr1	UTSW	6	108406145	missense	possibly damaging	0.95
R5308:Itpr1	UTSW	6	108356511	missense	probably damaging	1.00
R5339:Itpr1	UTSW	6	108393961	missense	probably damaging	1.00
R5368:Itpr1	UTSW	6	108387498	missense	probably damaging	1.00
R5369:Itpr1	UTSW	6	108519424	missense	probably damaging	0.99
R5419:Itpr1	UTSW	6	108493794	missense	possibly damaging	0.95
R5615:Itpr1	UTSW	6	108488600	missense	possibly damaging	0.71
R5779:Itpr1	UTSW	6	108352143	missense	probably damaging	1.00
R5781:Itpr1	UTSW	6	108510738	missense	probably benign	0.23
R5869:Itpr1	UTSW	6	108473529	missense	probably benign	0.30
R5903:Itpr1	UTSW	6	108489797	intron	probably benign
R5929:Itpr1	UTSW	6	108423336	missense	probably benign
R5956:Itpr1	UTSW	6	108506027	missense	probably benign	0.25
R6160:Itpr1	UTSW	6	108518755	missense	probably benign	0.06
R6163:Itpr1	UTSW	6	108388284	missense	probably damaging	1.00
R6169:Itpr1	UTSW	6	108369116	missense	probably damaging	1.00
R6237:Itpr1	UTSW	6	108378203	missense	possibly damaging	0.53
R6398:Itpr1	UTSW	6	108505903	missense	probably damaging	0.96
R6455:Itpr1	UTSW	6	108417972	missense	probably damaging	1.00
R6522:Itpr1	UTSW	6	108388276	missense	probably damaging	1.00
R6524:Itpr1	UTSW	6	108363683	missense	probably damaging	1.00
R6650:Itpr1	UTSW	6	108394073	splice site	probably null
R6806:Itpr1	UTSW	6	108515947	missense	probably benign
R6838:Itpr1	UTSW	6	108471191	missense	possibly damaging	0.87
R6841:Itpr1	UTSW	6	108388192	missense	probably damaging	1.00
R6896:Itpr1	UTSW	6	108481394	missense	probably damaging	1.00
R7076:Itpr1	UTSW	6	108388296	missense	probably benign
R7116:Itpr1	UTSW	6	108481268	missense	probably damaging	0.99
R7152:Itpr1	UTSW	6	108394407	critical splice donor site	probably null
R7161:Itpr1	UTSW	6	108386640	missense	probably damaging	1.00
R7166:Itpr1	UTSW	6	108378190	missense	probably benign	0.06
R7241:Itpr1	UTSW	6	108517620	critical splice donor site	probably null
R7301:Itpr1	UTSW	6	108542024	missense	possibly damaging	0.86
R7330:Itpr1	UTSW	6	108438331	missense	probably benign	0.28
R7449:Itpr1	UTSW	6	108389384	missense	probably damaging	0.98
R7472:Itpr1	UTSW	6	108403396	missense	probably benign	0.05
R7502:Itpr1	UTSW	6	108383678	missense	probably benign	0.00
R7779:Itpr1	UTSW	6	108523348	missense	possibly damaging	0.75
R7828:Itpr1	UTSW	6	108482931	missense	probably damaging	1.00
R7854:Itpr1	UTSW	6	108387369	missense	probably damaging	1.00
R7974:Itpr1	UTSW	6	108523405	missense	possibly damaging	0.86
R7998:Itpr1	UTSW	6	108417948	missense	possibly damaging	0.88
R8039:Itpr1	UTSW	6	108386628	missense	probably damaging	1.00
R8136:Itpr1	UTSW	6	108438360	missense	probably benign	0.18
R8200:Itpr1	UTSW	6	108394865	missense	probably benign	0.00
R8242:Itpr1	UTSW	6	108386697	missense	probably benign	0.44
R8322:Itpr1	UTSW	6	108388229	missense	probably benign	0.05
R8377:Itpr1	UTSW	6	108510738	missense	probably benign	0.00
R8412:Itpr1	UTSW	6	108363620	missense	probably benign	0.07
R8443:Itpr1	UTSW	6	108519348	missense	probably damaging	0.99
R8669:Itpr1	UTSW	6	108393967	missense	probably damaging	0.99
R8744:Itpr1	UTSW	6	108377802	missense	possibly damaging	0.79
Z1176:Itpr1	UTSW	6	108499149	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCATGTAACGGGTGATTC -3'
(R):5'- ATGGTGCATCCTCTCACTGG -3'

Sequencing Primer
(F):5'- CAGTGAAATCGCCTGTCTGTGAC -3'
(R):5'- TAGTCTGGCTCCACTGTCAGAG -3'

Posted On

2019-05-13