Incidental Mutation 'R7014:Arid3a'
ID545205
Institutional Source Beutler Lab
Gene Symbol Arid3a
Ensembl Gene ENSMUSG00000019564
Gene NameAT rich interactive domain 3A (BRIGHT-like)
SynonymsDri1, Bright
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7014 (G1)
Quality Score222.009
Status Validated
Chromosome10
Chromosomal Location79927043-79955018 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 79950884 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 488 (M488I)
Ref Sequence ENSEMBL: ENSMUSP00000101016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019708] [ENSMUST00000105376] [ENSMUST00000105377]
Predicted Effect possibly damaging
Transcript: ENSMUST00000019708
AA Change: M490I

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000019708
Gene: ENSMUSG00000019564
AA Change: M490I

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 27 34 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
coiled coil region 133 167 N/A INTRINSIC
ARID 240 331 2.1e-36 SMART
BRIGHT 244 336 7.73e-42 SMART
coiled coil region 436 462 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
low complexity region 555 583 N/A INTRINSIC
low complexity region 588 599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105376
AA Change: M490I

PolyPhen 2 Score 0.471 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101015
Gene: ENSMUSG00000019564
AA Change: M490I

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 27 34 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
coiled coil region 133 167 N/A INTRINSIC
ARID 240 331 2.1e-36 SMART
BRIGHT 244 336 7.73e-42 SMART
coiled coil region 436 462 N/A INTRINSIC
low complexity region 541 552 N/A INTRINSIC
low complexity region 555 583 N/A INTRINSIC
low complexity region 588 599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105377
AA Change: M488I

PolyPhen 2 Score 0.501 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101016
Gene: ENSMUSG00000019564
AA Change: M488I

DomainStartEndE-ValueType
low complexity region 12 26 N/A INTRINSIC
low complexity region 27 34 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
coiled coil region 133 167 N/A INTRINSIC
ARID 240 331 2.1e-36 SMART
BRIGHT 244 336 7.73e-42 SMART
coiled coil region 434 460 N/A INTRINSIC
low complexity region 539 550 N/A INTRINSIC
low complexity region 553 581 N/A INTRINSIC
low complexity region 586 597 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ARID (AT-rich interaction domain) family of DNA binding proteins. It was found by homology to the Drosophila dead ringer gene, which is important for normal embryogenesis. Other ARID family members have roles in embryonic patterning, cell lineage gene regulation, cell cycle control, transcriptional regulation, and possibly in chromatin structure modification. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E11.5 and E13.5 due to impaired erythropoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Parp9 T A 16: 35,960,063 probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Arid3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Arid3a APN 10 79950634 missense probably damaging 0.98
IGL02563:Arid3a APN 10 79950883 missense probably damaging 0.99
IGL03144:Arid3a APN 10 79946482 splice site probably benign
IGL03228:Arid3a APN 10 79950744 missense possibly damaging 0.80
IGL03347:Arid3a APN 10 79951279 missense possibly damaging 0.65
R0049:Arid3a UTSW 10 79931065 missense possibly damaging 0.66
R0408:Arid3a UTSW 10 79950833 missense probably benign 0.00
R0479:Arid3a UTSW 10 79951294 missense possibly damaging 0.80
R1938:Arid3a UTSW 10 79950706 missense probably damaging 0.99
R2190:Arid3a UTSW 10 79946531 missense possibly damaging 0.80
R4628:Arid3a UTSW 10 79931158 missense possibly damaging 0.95
R5184:Arid3a UTSW 10 79950769 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACCTGTATCTTTGGCAGGCC -3'
(R):5'- TCCTCTAGAAGGCCTTTTCCAAG -3'

Sequencing Primer
(F):5'- ACCCTGTTGTCGCAGCC -3'
(R):5'- ATGTAGCTCAAGTTAGCCCTG -3'
Posted On2019-05-13