Incidental Mutation 'R7014:Parp9'
ID545220
Institutional Source Beutler Lab
Gene Symbol Parp9
Ensembl Gene ENSMUSG00000022906
Gene Namepoly (ADP-ribose) polymerase family, member 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.168) question?
Stock #R7014 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location35938470-35972605 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 35960063 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023622] [ENSMUST00000023622] [ENSMUST00000023622] [ENSMUST00000114878] [ENSMUST00000114878] [ENSMUST00000114878]
Predicted Effect probably null
Transcript: ENSMUST00000023622
SMART Domains Protein: ENSMUSP00000023622
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
Pfam:Macro 74 182 1.5e-16 PFAM
PDB:3HKV|B 386 559 3e-9 PDB
SCOP:d1a26_2 403 521 1e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000023622
SMART Domains Protein: ENSMUSP00000023622
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
Pfam:Macro 74 182 1.5e-16 PFAM
PDB:3HKV|B 386 559 3e-9 PDB
SCOP:d1a26_2 403 521 1e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000023622
SMART Domains Protein: ENSMUSP00000023622
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
Pfam:Macro 74 182 1.5e-16 PFAM
PDB:3HKV|B 386 559 3e-9 PDB
SCOP:d1a26_2 403 521 1e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114878
SMART Domains Protein: ENSMUSP00000110528
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
A1pp 85 221 6.75e-33 SMART
A1pp 289 415 9.37e-9 SMART
PDB:3HKV|B 619 792 4e-8 PDB
SCOP:d1a26_2 636 754 1e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114878
SMART Domains Protein: ENSMUSP00000110528
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
A1pp 85 221 6.75e-33 SMART
A1pp 289 415 9.37e-9 SMART
PDB:3HKV|B 619 792 4e-8 PDB
SCOP:d1a26_2 636 754 1e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114878
SMART Domains Protein: ENSMUSP00000110528
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
A1pp 85 221 6.75e-33 SMART
A1pp 289 415 9.37e-9 SMART
PDB:3HKV|B 619 792 4e-8 PDB
SCOP:d1a26_2 636 754 1e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159160
SMART Domains Protein: ENSMUSP00000124098
Gene: ENSMUSG00000022906

DomainStartEndE-ValueType
Pfam:Macro 29 100 8.3e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.2%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022A10Rik C T 7: 27,578,773 Q156* probably null Het
2700097O09Rik A G 12: 55,045,942 I264T probably benign Het
Arid3a G T 10: 79,950,884 M488I possibly damaging Het
Auts2 A G 5: 131,466,123 F331S probably damaging Het
Axdnd1 T C 1: 156,330,962 probably null Het
Bpifb5 C A 2: 154,224,956 S43* probably null Het
Carhsp1 A G 16: 8,661,005 V128A probably benign Het
Ccdc141 A G 2: 77,132,297 V101A probably damaging Het
Cdk6 C G 5: 3,473,152 L191V probably damaging Het
Cgnl1 T G 9: 71,725,134 K312Q possibly damaging Het
Col6a1 T C 10: 76,721,443 E225G probably damaging Het
Copg1 T A 6: 87,902,340 L456Q probably damaging Het
Ctif T A 18: 75,437,208 D540V possibly damaging Het
Cyfip1 T C 7: 55,919,493 I917T probably benign Het
Cyth1 T C 11: 118,212,651 D9G probably benign Het
Dnajb1 T C 8: 83,610,255 I118T probably damaging Het
Ebna1bp2 T A 4: 118,623,378 Y139* probably null Het
Fam162a A T 16: 36,049,932 V59E probably damaging Het
Fam213a T C 14: 41,002,494 E71G probably benign Het
Fhad1 CGG CG 4: 141,918,291 probably null Het
Fmo6 C G 1: 162,926,308 R112T probably benign Het
Gm11639 A G 11: 104,693,422 T100A probably benign Het
Gm17087 T A 17: 8,566,472 D133V probably benign Het
Gm17689 C A 9: 36,582,558 W26C unknown Het
Gm21994 A T 2: 150,255,262 C82* probably null Het
Gm42669 A G 5: 107,508,276 I802V probably benign Het
Gp2 T C 7: 119,451,645 N288D probably damaging Het
Gstm7 C T 3: 107,926,962 D196N probably benign Het
Hsph1 A T 5: 149,630,400 V201D probably damaging Het
Il20ra T C 10: 19,712,710 L26P unknown Het
Itpr1 T A 6: 108,431,498 probably null Het
Kcns3 A T 12: 11,091,687 I337N probably damaging Het
Kdm4d A G 9: 14,464,179 Y128H probably damaging Het
Kirrel2 A G 7: 30,454,574 I200T probably benign Het
Klhdc10 T A 6: 30,450,503 I294N probably damaging Het
Map1a A C 2: 121,300,239 N512T probably damaging Het
March8 C G 6: 116,403,543 C118W probably damaging Het
March8 T G 6: 116,403,544 C119G probably damaging Het
Mrpl38 G T 11: 116,134,915 P195Q probably damaging Het
Ms4a4d A T 19: 11,548,583 Q27L probably benign Het
Muc16 T A 9: 18,658,236 T996S unknown Het
Mug1 C T 6: 121,861,125 A438V probably benign Het
Mup7 T A 4: 60,069,866 I33F probably damaging Het
Ndufa5 C T 6: 24,519,191 probably null Het
Olfr1133 A T 2: 87,645,976 L49Q probably damaging Het
Olfr1141 T C 2: 87,753,871 I41V probably benign Het
Olfr1535 A G 13: 21,555,938 F28S probably benign Het
Olfr167 A T 16: 19,515,456 F60Y probably benign Het
Olfr873 T A 9: 20,300,663 C154* probably null Het
Pbx1 T A 1: 168,431,380 D42V probably damaging Het
Pde4dip G T 3: 97,715,422 N1490K possibly damaging Het
Pdzd2 T C 15: 12,372,561 N2496S probably benign Het
Pdzd2 A G 15: 12,372,975 M2358T probably benign Het
Pglyrp2 C A 17: 32,415,930 C486F probably damaging Het
Pi4ka A G 16: 17,297,067 probably benign Het
Pknox2 T A 9: 36,909,667 T300S probably damaging Het
Plekhm3 A G 1: 64,883,270 I582T probably damaging Het
Prtg T C 9: 72,891,985 Y766H possibly damaging Het
Rabgap1 A G 2: 37,560,563 E901G probably benign Het
Rabgap1l A T 1: 160,342,072 N60K probably damaging Het
Rnf150 C T 8: 83,042,663 T359I probably benign Het
Rps6ka2 C T 17: 7,255,932 H236Y probably benign Het
Rrp1b T A 17: 32,049,427 L120Q probably damaging Het
Scn7a C A 2: 66,741,959 G223C probably null Het
Sema6a T A 18: 47,298,217 N138I probably damaging Het
Sept5 T A 16: 18,624,909 I97F probably damaging Het
Shcbp1 T A 8: 4,754,234 E225D probably damaging Het
Slc25a19 A G 11: 115,620,966 C124R probably damaging Het
Slc37a2 C T 9: 37,233,887 A428T probably damaging Het
Slc5a12 A G 2: 110,644,364 I538V probably benign Het
Slco4c1 A T 1: 96,823,781 probably null Het
Smarcad1 T C 6: 65,052,670 S81P probably damaging Het
Smyd1 T C 6: 71,238,627 D116G probably damaging Het
Themis T C 10: 28,789,707 Y589H probably benign Het
Trim30d T C 7: 104,483,336 K248R probably benign Het
Tspan12 C T 6: 21,772,919 M210I probably benign Het
Vmn2r11 T C 5: 109,053,423 Y405C probably damaging Het
Wdfy3 A G 5: 101,894,909 probably null Het
Wiz C A 17: 32,361,866 A83S probably damaging Het
Zmym6 T A 4: 127,123,544 Y947* probably null Het
Other mutations in Parp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Parp9 APN 16 35947998 missense probably damaging 1.00
IGL01365:Parp9 APN 16 35947954 missense possibly damaging 0.71
IGL01628:Parp9 APN 16 35956915 missense possibly damaging 0.58
IGL02274:Parp9 APN 16 35947947 missense probably damaging 1.00
IGL02693:Parp9 APN 16 35956970 missense probably benign 0.01
R0109:Parp9 UTSW 16 35948341 missense probably damaging 0.97
R0109:Parp9 UTSW 16 35948341 missense probably damaging 0.97
R0559:Parp9 UTSW 16 35947992 missense probably benign 0.00
R1126:Parp9 UTSW 16 35947740 missense possibly damaging 0.53
R1346:Parp9 UTSW 16 35956897 missense probably benign 0.00
R1472:Parp9 UTSW 16 35953680 missense possibly damaging 0.78
R1642:Parp9 UTSW 16 35967697 missense probably benign 0.37
R1900:Parp9 UTSW 16 35972221 missense probably benign 0.00
R2055:Parp9 UTSW 16 35953614 missense probably damaging 0.97
R3177:Parp9 UTSW 16 35948208 missense probably damaging 0.99
R3277:Parp9 UTSW 16 35948208 missense probably damaging 0.99
R4039:Parp9 UTSW 16 35960047 missense probably damaging 1.00
R4869:Parp9 UTSW 16 35956904 missense probably damaging 0.99
R4950:Parp9 UTSW 16 35948007 missense probably damaging 1.00
R5112:Parp9 UTSW 16 35964313 missense probably damaging 1.00
R5117:Parp9 UTSW 16 35971832 splice site probably null
R5180:Parp9 UTSW 16 35953736 nonsense probably null
R5415:Parp9 UTSW 16 35943382 missense probably damaging 0.97
R5535:Parp9 UTSW 16 35956825 missense probably damaging 0.98
R5727:Parp9 UTSW 16 35964097 nonsense probably null
R5842:Parp9 UTSW 16 35943408 missense possibly damaging 0.46
R5942:Parp9 UTSW 16 35971889 missense possibly damaging 0.90
R6110:Parp9 UTSW 16 35953626 missense possibly damaging 0.86
R6193:Parp9 UTSW 16 35947551 missense possibly damaging 0.64
R6707:Parp9 UTSW 16 35947933 missense probably damaging 1.00
R6957:Parp9 UTSW 16 35948346 missense probably benign 0.00
R7064:Parp9 UTSW 16 35953672 missense probably benign 0.07
R7205:Parp9 UTSW 16 35956990 missense probably benign 0.00
R7221:Parp9 UTSW 16 35953701 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACATTCTCTTGGCTTGTCTAAGG -3'
(R):5'- ACTAGGCCAGAGTTCCTGAC -3'

Sequencing Primer
(F):5'- GTGGGAATGGAGTCTACT -3'
(R):5'- GTTCCTGACTCAGAATTGGTAATGAG -3'
Posted On2019-05-13