Incidental Mutation 'R7015:Il11ra1'
ID545240
Institutional Source Beutler Lab
Gene Symbol Il11ra1
Ensembl Gene ENSMUSG00000073889
Gene Nameinterleukin 11 receptor, alpha chain 1
SynonymsIl11ra, Il-11ra, NR1, Il-11ra-alpha
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.726) question?
Stock #R7015 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location41699989-41769474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41765421 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 172 (Q172L)
Ref Sequence ENSEMBL: ENSMUSP00000103677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074387] [ENSMUST00000098132] [ENSMUST00000108033] [ENSMUST00000108035] [ENSMUST00000108036] [ENSMUST00000108037] [ENSMUST00000108040] [ENSMUST00000108041] [ENSMUST00000108042] [ENSMUST00000131349] [ENSMUST00000151142] [ENSMUST00000155322]
Predicted Effect probably benign
Transcript: ENSMUST00000074387
SMART Domains Protein: ENSMUSP00000073990
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
SCY 31 97 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098132
AA Change: Q172L

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000095736
Gene: ENSMUSG00000073889
AA Change: Q172L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108033
SMART Domains Protein: ENSMUSP00000103668
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
SCY 30 96 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108035
SMART Domains Protein: ENSMUSP00000103670
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 38 104 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108036
SMART Domains Protein: ENSMUSP00000103671
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108037
SMART Domains Protein: ENSMUSP00000103672
Gene: ENSMUSG00000073888

DomainStartEndE-ValueType
SCY 75 141 5.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108040
AA Change: Q172L

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103675
Gene: ENSMUSG00000073889
AA Change: Q172L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
AA Change: Q172L

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889
AA Change: Q172L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108042
AA Change: Q172L

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000103677
Gene: ENSMUSG00000073889
AA Change: Q172L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131349
Predicted Effect probably benign
Transcript: ENSMUST00000151142
Predicted Effect probably benign
Transcript: ENSMUST00000155322
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 93% (55/59)
MGI Phenotype PHENOTYPE: Female homozygotes for targeted null mutations are infertile due to defective decidua formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A G 1: 160,075,168 R3G possibly damaging Het
Abcc2 A G 19: 43,798,178 I150V probably benign Het
Adgrb1 T C 15: 74,574,110 L1085P probably damaging Het
Agbl4 A G 4: 110,478,500 N24D probably damaging Het
Aox2 A G 1: 58,282,758 T70A probably benign Het
Aplf G A 6: 87,641,902 A399V probably damaging Het
Asxl3 A G 18: 22,523,921 S1663G probably benign Het
Bcat1 G C 6: 145,039,583 P43R probably damaging Het
Camk1 T C 6: 113,341,926 R9G probably benign Het
Casp8ap2 T C 4: 32,644,278 V1117A probably damaging Het
Cd300ld4 A T 11: 115,022,707 V174E probably benign Het
Cep85l T C 10: 53,349,055 D146G possibly damaging Het
Clip1 T C 5: 123,613,612 probably benign Het
Cog3 C T 14: 75,713,276 V719I possibly damaging Het
Col4a4 G A 1: 82,506,950 P532L unknown Het
Col6a4 C T 9: 106,033,755 probably null Het
Dync1h1 C T 12: 110,666,087 Q4547* probably null Het
Ergic1 G A 17: 26,654,879 probably benign Het
Foxn4 G A 5: 114,256,855 T337M possibly damaging Het
Gemin5 A T 11: 58,156,740 I336N probably damaging Het
Gm21905 A T 5: 67,946,362 probably null Het
Grik2 C A 10: 49,535,436 R202L probably damaging Het
Iglon5 T C 7: 43,476,927 D184G probably benign Het
Me2 G T 18: 73,781,147 probably null Het
Med24 A G 11: 98,718,852 V73A possibly damaging Het
Mmp24 A G 2: 155,792,624 Q88R probably damaging Het
Mroh3 A T 1: 136,183,331 V819E probably damaging Het
Mrps9 A G 1: 42,898,546 K247R probably benign Het
Myo15b G A 11: 115,871,844 R1254H Het
Ncoa5 A G 2: 165,002,081 L134P probably benign Het
Olfr628 T C 7: 103,732,817 V297A probably null Het
Olfr78 C A 7: 102,742,444 L186F probably damaging Het
Olfr984 A T 9: 40,101,455 F12I probably benign Het
Pdcd11 A G 19: 47,098,226 I224V probably benign Het
Ptprh C A 7: 4,552,627 probably null Het
Rab34 G T 11: 78,190,152 V63F probably damaging Het
Rack1 T C 11: 48,801,765 I71T probably benign Het
Rai14 G A 15: 10,589,315 R266* probably null Het
Rsph9 A G 17: 46,129,456 V238A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sel1l3 A T 5: 53,172,574 C480S probably benign Het
Sh3pxd2a C T 19: 47,268,123 A747T probably benign Het
Slc1a3 T C 15: 8,649,568 N181S probably damaging Het
Slit1 T A 19: 41,629,886 K784* probably null Het
Sos2 T A 12: 69,585,235 Q1297L probably benign Het
Srd5a2 T A 17: 74,027,119 T102S probably benign Het
Ss18l2 A T 9: 121,712,608 I64F probably damaging Het
Tas2r120 T C 6: 132,657,165 F70S possibly damaging Het
Tjap1 G A 17: 46,263,774 A5V possibly damaging Het
Tln2 A T 9: 67,362,647 M488K possibly damaging Het
Tnks T G 8: 34,838,547 I42L probably benign Het
Togaram2 A T 17: 71,709,568 Q640L possibly damaging Het
Triobp C A 15: 78,994,060 Q1682K probably damaging Het
Trip11 C T 12: 101,893,683 E311K probably damaging Het
Ugt2b5 A G 5: 87,139,796 Y171H probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Zfp990 G T 4: 145,536,635 D68Y probably damaging Het
Zranb2 A T 3: 157,536,733 probably null Het
Other mutations in Il11ra1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02681:Il11ra1 APN 4 41768552 missense possibly damaging 0.73
R0013:Il11ra1 UTSW 4 41765060 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0032:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R0365:Il11ra1 UTSW 4 41767527 missense probably damaging 1.00
R0399:Il11ra1 UTSW 4 41766185 missense probably benign 0.03
R1585:Il11ra1 UTSW 4 41768207 missense probably damaging 0.98
R1591:Il11ra1 UTSW 4 41766200 missense probably damaging 1.00
R2424:Il11ra1 UTSW 4 41768222 missense probably damaging 1.00
R3037:Il11ra1 UTSW 4 41765074 missense possibly damaging 0.94
R4393:Il11ra1 UTSW 4 41768577 critical splice donor site probably null
R4770:Il11ra1 UTSW 4 41768187 missense probably damaging 1.00
R4798:Il11ra1 UTSW 4 41766096 unclassified probably benign
R5256:Il11ra1 UTSW 4 41767932 unclassified probably benign
R6005:Il11ra1 UTSW 4 41763887 critical splice donor site probably null
R6309:Il11ra1 UTSW 4 41765279 missense possibly damaging 0.87
R6499:Il11ra1 UTSW 4 41765412 missense probably benign 0.04
R6833:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
R6834:Il11ra1 UTSW 4 41765454 missense probably benign 0.00
R7122:Il11ra1 UTSW 4 41766189 missense probably damaging 0.99
R7275:Il11ra1 UTSW 4 41765109 missense probably damaging 1.00
R7710:Il11ra1 UTSW 4 41764846 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAGGTTCTGACAAATTCTCAG -3'
(R):5'- AAGTCTGTGCGGAGTCTCTG -3'

Sequencing Primer
(F):5'- AAGGTAGGGGCCTTCTTTCCC -3'
(R):5'- CTCTGTGACATGGGTCTGGAAG -3'
Posted On2019-05-13