Mutagenetix > Incidental Mutation

Incidental Mutation 'R7015:Sel1l3'

545243

Institutional Source

Beutler Lab

Gene Symbol

Sel1l3

Ensembl Gene

ENSMUSG00000029189

Gene Name

sel-1 suppressor of lin-12-like 3 (C. elegans)

Synonyms

2310045A20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7015 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53107083-53213927 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53172574 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 480 (C480S)

Ref Sequence

ENSEMBL: ENSMUSP00000031090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031090]

AlphaFold

Q80TS8

Predicted Effect

probably benign
Transcript: ENSMUST00000031090
AA Change: C480S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: C480S

Domain	Start	End	E-Value	Type
low complexity region	11	33	N/A	INTRINSIC
SEL1	575	609	3.39e1	SMART
SEL1	611	647	1.85e1	SMART
SEL1	694	730	5.27e-5	SMART
SEL1	732	767	2.94e-3	SMART
SEL1	768	800	5.32e-1	SMART
SEL1	801	839	1.23e-5	SMART
SEL1	840	877	8.55e1	SMART
SEL1	952	988	2.56e-3	SMART
low complexity region	1048	1058	N/A	INTRINSIC
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1102	1127	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

93% (55/59)

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	A	G	1: 160,075,168	R3G	possibly damaging	Het
Abcc2	A	G	19: 43,798,178	I150V	probably benign	Het
Adgrb1	T	C	15: 74,574,110	L1085P	probably damaging	Het
Agbl4	A	G	4: 110,478,500	N24D	probably damaging	Het
Aox2	A	G	1: 58,282,758	T70A	probably benign	Het
Aplf	G	A	6: 87,641,902	A399V	probably damaging	Het
Asxl3	A	G	18: 22,523,921	S1663G	probably benign	Het
Bcat1	G	C	6: 145,039,583	P43R	probably damaging	Het
Camk1	T	C	6: 113,341,926	R9G	probably benign	Het
Casp8ap2	T	C	4: 32,644,278	V1117A	probably damaging	Het
Cd300ld4	A	T	11: 115,022,707	V174E	probably benign	Het
Cep85l	T	C	10: 53,349,055	D146G	possibly damaging	Het
Clip1	T	C	5: 123,613,612		probably benign	Het
Cog3	C	T	14: 75,713,276	V719I	possibly damaging	Het
Col4a4	G	A	1: 82,506,950	P532L	unknown	Het
Col6a4	C	T	9: 106,033,755		probably null	Het
Dync1h1	C	T	12: 110,666,087	Q4547*	probably null	Het
Ergic1	G	A	17: 26,654,879		probably benign	Het
Foxn4	G	A	5: 114,256,855	T337M	possibly damaging	Het
Gemin5	A	T	11: 58,156,740	I336N	probably damaging	Het
Gm21905	A	T	5: 67,946,362		probably null	Het
Grik2	C	A	10: 49,535,436	R202L	probably damaging	Het
Iglon5	T	C	7: 43,476,927	D184G	probably benign	Het
Il11ra1	A	T	4: 41,765,421	Q172L	probably benign	Het
Me2	G	T	18: 73,781,147		probably null	Het
Med24	A	G	11: 98,718,852	V73A	possibly damaging	Het
Mmp24	A	G	2: 155,792,624	Q88R	probably damaging	Het
Mroh3	A	T	1: 136,183,331	V819E	probably damaging	Het
Mrps9	A	G	1: 42,898,546	K247R	probably benign	Het
Myo15b	G	A	11: 115,871,844	R1254H		Het
Ncoa5	A	G	2: 165,002,081	L134P	probably benign	Het
Olfr628	T	C	7: 103,732,817	V297A	probably null	Het
Olfr78	C	A	7: 102,742,444	L186F	probably damaging	Het
Olfr984	A	T	9: 40,101,455	F12I	probably benign	Het
Pdcd11	A	G	19: 47,098,226	I224V	probably benign	Het
Ptprh	C	A	7: 4,552,627		probably null	Het
Rab34	G	T	11: 78,190,152	V63F	probably damaging	Het
Rack1	T	C	11: 48,801,765	I71T	probably benign	Het
Rai14	G	A	15: 10,589,315	R266*	probably null	Het
Rsph9	A	G	17: 46,129,456	V238A	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Sh3pxd2a	C	T	19: 47,268,123	A747T	probably benign	Het
Slc1a3	T	C	15: 8,649,568	N181S	probably damaging	Het
Slit1	T	A	19: 41,629,886	K784*	probably null	Het
Sos2	T	A	12: 69,585,235	Q1297L	probably benign	Het
Srd5a2	T	A	17: 74,027,119	T102S	probably benign	Het
Ss18l2	A	T	9: 121,712,608	I64F	probably damaging	Het
Tas2r120	T	C	6: 132,657,165	F70S	possibly damaging	Het
Tjap1	G	A	17: 46,263,774	A5V	possibly damaging	Het
Tln2	A	T	9: 67,362,647	M488K	possibly damaging	Het
Tnks	T	G	8: 34,838,547	I42L	probably benign	Het
Togaram2	A	T	17: 71,709,568	Q640L	possibly damaging	Het
Triobp	C	A	15: 78,994,060	Q1682K	probably damaging	Het
Trip11	C	T	12: 101,893,683	E311K	probably damaging	Het
Ugt2b5	A	G	5: 87,139,796	Y171H	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Zfp990	G	T	4: 145,536,635	D68Y	probably damaging	Het
Zranb2	A	T	3: 157,536,733		probably null	Het

Other mutations in Sel1l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Sel1l3	APN	5	53116333	missense	probably damaging	0.96
IGL01585:Sel1l3	APN	5	53154236	missense	probably damaging	0.99
IGL01717:Sel1l3	APN	5	53200168	missense	probably damaging	0.99
IGL01771:Sel1l3	APN	5	53121841	missense	probably damaging	0.99
IGL01926:Sel1l3	APN	5	53200143	missense	probably benign	0.26
IGL01963:Sel1l3	APN	5	53200338	missense	probably damaging	0.99
IGL02000:Sel1l3	APN	5	53145493	missense	probably damaging	1.00
IGL02132:Sel1l3	APN	5	53170405	missense	possibly damaging	0.89
IGL02198:Sel1l3	APN	5	53139799	splice site	probably benign
IGL02930:Sel1l3	APN	5	53123217	missense	possibly damaging	0.65
IGL03146:Sel1l3	APN	5	53154243	missense	probably benign	0.00
IGL03175:Sel1l3	APN	5	53121857	missense	probably damaging	1.00
R0083:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0940:Sel1l3	UTSW	5	53144037	splice site	probably benign
R1027:Sel1l3	UTSW	5	53145478	missense	possibly damaging	0.68
R1117:Sel1l3	UTSW	5	53172607	missense	probably benign	0.00
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1345:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1370:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1503:Sel1l3	UTSW	5	53137929	missense	probably damaging	0.98
R1747:Sel1l3	UTSW	5	53145545	missense	possibly damaging	0.91
R1764:Sel1l3	UTSW	5	53170447	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R3434:Sel1l3	UTSW	5	53117090	missense	probably benign	0.44
R4043:Sel1l3	UTSW	5	53188054	nonsense	probably null
R4074:Sel1l3	UTSW	5	53154287	missense	probably damaging	0.99
R4727:Sel1l3	UTSW	5	53144183	critical splice acceptor site	probably null
R4788:Sel1l3	UTSW	5	53131833	missense	probably benign	0.41
R4900:Sel1l3	UTSW	5	53131842	missense	probably damaging	1.00
R5000:Sel1l3	UTSW	5	53200434	missense	probably damaging	0.97
R5090:Sel1l3	UTSW	5	53200046	missense	probably benign	0.03
R5330:Sel1l3	UTSW	5	53186009	missense	possibly damaging	0.80
R5456:Sel1l3	UTSW	5	53200036	missense	probably benign	0.13
R5544:Sel1l3	UTSW	5	53200302	missense	probably damaging	0.98
R5848:Sel1l3	UTSW	5	53184808	missense	possibly damaging	0.91
R6132:Sel1l3	UTSW	5	53200189	missense	possibly damaging	0.77
R6188:Sel1l3	UTSW	5	53155719	missense	possibly damaging	0.70
R6622:Sel1l3	UTSW	5	53139860	missense	probably damaging	0.98
R7200:Sel1l3	UTSW	5	53144109	missense	probably benign	0.22
R7271:Sel1l3	UTSW	5	53116362	missense	probably damaging	0.98
R7378:Sel1l3	UTSW	5	53116409	missense	probably benign	0.02
R7479:Sel1l3	UTSW	5	53117120	missense	probably damaging	0.99
R7563:Sel1l3	UTSW	5	53185984	missense	probably damaging	1.00
R7643:Sel1l3	UTSW	5	53123162	splice site	probably null
R7741:Sel1l3	UTSW	5	53200251	missense	probably damaging	1.00
R7743:Sel1l3	UTSW	5	53135885	missense	probably benign	0.07
R7861:Sel1l3	UTSW	5	53144064	missense	probably damaging	0.96
R7904:Sel1l3	UTSW	5	53139824	missense	probably benign	0.24
R8222:Sel1l3	UTSW	5	53187954	critical splice donor site	probably null
R8724:Sel1l3	UTSW	5	53135823	nonsense	probably null
R8788:Sel1l3	UTSW	5	53174806	nonsense	probably null
R8988:Sel1l3	UTSW	5	53123429	missense	probably damaging	0.96
R9111:Sel1l3	UTSW	5	53121871	splice site	probably benign
R9153:Sel1l3	UTSW	5	53135846	missense	probably benign	0.26
R9269:Sel1l3	UTSW	5	53154286	missense	probably damaging	1.00
R9399:Sel1l3	UTSW	5	53108144	missense	probably benign
R9455:Sel1l3	UTSW	5	53131815	missense	probably damaging	0.99
R9630:Sel1l3	UTSW	5	53184775	missense	possibly damaging	0.49
R9793:Sel1l3	UTSW	5	53172582	missense	probably benign	0.02
R9795:Sel1l3	UTSW	5	53172582	missense	probably benign	0.02
Z1088:Sel1l3	UTSW	5	53116196	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AAGGCAGAACGCACATGCTG -3'
(R):5'- GGATGGTAGCCAGTGATGTC -3'

Sequencing Primer
(F):5'- GGTCCCCATCTGTCTTTGGAAG -3'
(R):5'- GTCCTACTAGCCAGAGGACATTTG -3'

Posted On

2019-05-13