Mutagenetix > Incidental Mutation

Incidental Mutation 'R7015:Clip1'

545246

Institutional Source

Beutler Lab

Gene Symbol

Clip1

Ensembl Gene

ENSMUSG00000049550

Gene Name

CAP-GLY domain containing linker protein 1

Synonyms

Clip50, 4631429H07Rik, CLIP-170, restin, Rsn, Clip 170, 1110007I12Rik, cytoplasmic linker protein 50

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7015 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

123577795-123684618 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

T to C at 123613612 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000115965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031382] [ENSMUST00000063905] [ENSMUST00000111561] [ENSMUST00000111564] [ENSMUST00000111566] [ENSMUST00000149410]

AlphaFold

Q922J3

Predicted Effect

probably benign
Transcript: ENSMUST00000031382

SMART Domains

Protein: ENSMUSP00000031382
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.28e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.28e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	451	N/A	INTRINSIC
coiled coil region	474	535	N/A	INTRINSIC
coiled coil region	581	620	N/A	INTRINSIC
coiled coil region	652	1352	N/A	INTRINSIC
low complexity region	1362	1373	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1375	1392	5.8e-9	PFAM
ZnF_C2HC	1417	1433	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000063905

SMART Domains

Protein: ENSMUSP00000068241
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	3.3e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	3.3e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1075	N/A	INTRINSIC
coiled coil region	1115	1235	N/A	INTRINSIC
low complexity region	1245	1256	N/A	INTRINSIC
ZnF_C2HC	1300	1316	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111561

SMART Domains

Protein: ENSMUSP00000107186
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	1.93e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	1.93e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	524	N/A	INTRINSIC
coiled coil region	570	609	N/A	INTRINSIC
coiled coil region	641	1341	N/A	INTRINSIC
low complexity region	1351	1362	N/A	INTRINSIC
ZnF_C2HC	1406	1422	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111564

SMART Domains

Protein: ENSMUSP00000107190
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2.5e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2.5e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1230	N/A	INTRINSIC
low complexity region	1240	1251	N/A	INTRINSIC
ZnF_C2HC	1295	1311	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000111566

SMART Domains

Protein: ENSMUSP00000107192
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
internal_repeat_2	11	53	2e-5	PROSPERO
CAP_GLY	60	125	1.05e-31	SMART
internal_repeat_2	140	177	2e-5	PROSPERO
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	349	489	N/A	INTRINSIC
coiled coil region	535	574	N/A	INTRINSIC
coiled coil region	606	1306	N/A	INTRINSIC
low complexity region	1316	1327	N/A	INTRINSIC
ZnF_C2HC	1371	1387	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000137363

SMART Domains

Protein: ENSMUSP00000121425
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
CAP_GLY	2	31	2.59e0	SMART
low complexity region	39	57	N/A	INTRINSIC
low complexity region	58	84	N/A	INTRINSIC
coiled coil region	101	276	N/A	INTRINSIC
coiled coil region	322	361	N/A	INTRINSIC
coiled coil region	393	980	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
Pfam:CLIP1_ZNF	1004	1021	4.2e-9	PFAM
ZnF_C2HC	1046	1062	1.45e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000144121

SMART Domains

Protein: ENSMUSP00000119641
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
CAP_GLY	37	102	1.05e-31	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000149410

SMART Domains

Protein: ENSMUSP00000115965
Gene: ENSMUSG00000049550

Domain	Start	End	E-Value	Type
low complexity region	26	32	N/A	INTRINSIC
CAP_GLY	60	125	1.05e-31	SMART
CAP_GLY	213	278	4.69e-34	SMART
low complexity region	286	304	N/A	INTRINSIC
low complexity region	305	331	N/A	INTRINSIC
coiled coil region	334	458	N/A	INTRINSIC
coiled coil region	504	543	N/A	INTRINSIC
coiled coil region	575	827	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122064
Gene: ENSMUSG00000049550
AA Change: E702G

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
low complexity region	165	176	N/A	INTRINSIC
internal_repeat_1	352	375	1.56e-8	PROSPERO
internal_repeat_3	358	377	5.32e-6	PROSPERO
internal_repeat_1	450	473	1.56e-8	PROSPERO
internal_repeat_3	544	563	5.32e-6	PROSPERO
internal_repeat_2	553	575	2.88e-7	PROSPERO
low complexity region	735	744	N/A	INTRINSIC
internal_repeat_2	781	803	2.88e-7	PROSPERO
low complexity region	819	830	N/A	INTRINSIC
low complexity region	962	977	N/A	INTRINSIC
low complexity region	1081	1099	N/A	INTRINSIC
low complexity region	1110	1121	N/A	INTRINSIC
low complexity region	1164	1175	N/A	INTRINSIC

Meta Mutation Damage Score

0.0631

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

93% (55/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene links endocytic vesicles to microtubules. This gene is highly expressed in Reed-Sternberg cells of Hodgkin disease. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted allele display reduced male fertility and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	A	G	1: 160,075,168	R3G	possibly damaging	Het
Abcc2	A	G	19: 43,798,178	I150V	probably benign	Het
Adgrb1	T	C	15: 74,574,110	L1085P	probably damaging	Het
Agbl4	A	G	4: 110,478,500	N24D	probably damaging	Het
Aox2	A	G	1: 58,282,758	T70A	probably benign	Het
Aplf	G	A	6: 87,641,902	A399V	probably damaging	Het
Asxl3	A	G	18: 22,523,921	S1663G	probably benign	Het
Bcat1	G	C	6: 145,039,583	P43R	probably damaging	Het
Camk1	T	C	6: 113,341,926	R9G	probably benign	Het
Casp8ap2	T	C	4: 32,644,278	V1117A	probably damaging	Het
Cd300ld4	A	T	11: 115,022,707	V174E	probably benign	Het
Cep85l	T	C	10: 53,349,055	D146G	possibly damaging	Het
Cog3	C	T	14: 75,713,276	V719I	possibly damaging	Het
Col4a4	G	A	1: 82,506,950	P532L	unknown	Het
Col6a4	C	T	9: 106,033,755		probably null	Het
Dync1h1	C	T	12: 110,666,087	Q4547*	probably null	Het
Ergic1	G	A	17: 26,654,879		probably benign	Het
Foxn4	G	A	5: 114,256,855	T337M	possibly damaging	Het
Gemin5	A	T	11: 58,156,740	I336N	probably damaging	Het
Gm21905	A	T	5: 67,946,362		probably null	Het
Grik2	C	A	10: 49,535,436	R202L	probably damaging	Het
Iglon5	T	C	7: 43,476,927	D184G	probably benign	Het
Il11ra1	A	T	4: 41,765,421	Q172L	probably benign	Het
Me2	G	T	18: 73,781,147		probably null	Het
Med24	A	G	11: 98,718,852	V73A	possibly damaging	Het
Mmp24	A	G	2: 155,792,624	Q88R	probably damaging	Het
Mroh3	A	T	1: 136,183,331	V819E	probably damaging	Het
Mrps9	A	G	1: 42,898,546	K247R	probably benign	Het
Myo15b	G	A	11: 115,871,844	R1254H		Het
Ncoa5	A	G	2: 165,002,081	L134P	probably benign	Het
Olfr628	T	C	7: 103,732,817	V297A	probably null	Het
Olfr78	C	A	7: 102,742,444	L186F	probably damaging	Het
Olfr984	A	T	9: 40,101,455	F12I	probably benign	Het
Pdcd11	A	G	19: 47,098,226	I224V	probably benign	Het
Ptprh	C	A	7: 4,552,627		probably null	Het
Rab34	G	T	11: 78,190,152	V63F	probably damaging	Het
Rack1	T	C	11: 48,801,765	I71T	probably benign	Het
Rai14	G	A	15: 10,589,315	R266*	probably null	Het
Rsph9	A	G	17: 46,129,456	V238A	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Sel1l3	A	T	5: 53,172,574	C480S	probably benign	Het
Sh3pxd2a	C	T	19: 47,268,123	A747T	probably benign	Het
Slc1a3	T	C	15: 8,649,568	N181S	probably damaging	Het
Slit1	T	A	19: 41,629,886	K784*	probably null	Het
Sos2	T	A	12: 69,585,235	Q1297L	probably benign	Het
Srd5a2	T	A	17: 74,027,119	T102S	probably benign	Het
Ss18l2	A	T	9: 121,712,608	I64F	probably damaging	Het
Tas2r120	T	C	6: 132,657,165	F70S	possibly damaging	Het
Tjap1	G	A	17: 46,263,774	A5V	possibly damaging	Het
Tln2	A	T	9: 67,362,647	M488K	possibly damaging	Het
Tnks	T	G	8: 34,838,547	I42L	probably benign	Het
Togaram2	A	T	17: 71,709,568	Q640L	possibly damaging	Het
Triobp	C	A	15: 78,994,060	Q1682K	probably damaging	Het
Trip11	C	T	12: 101,893,683	E311K	probably damaging	Het
Ugt2b5	A	G	5: 87,139,796	Y171H	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Zfp990	G	T	4: 145,536,635	D68Y	probably damaging	Het
Zranb2	A	T	3: 157,536,733		probably null	Het

Other mutations in Clip1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00159:Clip1	APN	5	123603654	missense	possibly damaging	0.94
IGL01067:Clip1	APN	5	123630804	missense	probably damaging	0.99
IGL01524:Clip1	APN	5	123579379	missense	probably damaging	1.00
IGL01632:Clip1	APN	5	123617496	missense	probably damaging	1.00
IGL01798:Clip1	APN	5	123583549	missense	probably damaging	1.00
IGL01874:Clip1	APN	5	123603666	missense	possibly damaging	0.50
IGL01908:Clip1	APN	5	123623207	splice site	probably benign
IGL02120:Clip1	APN	5	123647883	missense	probably damaging	1.00
IGL02309:Clip1	APN	5	123617700	missense	probably damaging	0.99
IGL02555:Clip1	APN	5	123621794	critical splice donor site	probably null
IGL03027:Clip1	APN	5	123621856	missense	probably benign	0.43
IGL03336:Clip1	APN	5	123653570	nonsense	probably null
IGL03365:Clip1	APN	5	123583586	missense	probably damaging	1.00
IGL02802:Clip1	UTSW	5	123631123	missense	probably damaging	1.00
PIT4812001:Clip1	UTSW	5	123630675	missense	probably benign	0.08
R0254:Clip1	UTSW	5	123617332	splice site	probably benign
R0401:Clip1	UTSW	5	123653789	missense	probably damaging	1.00
R0530:Clip1	UTSW	5	123640531	missense	probably damaging	1.00
R0744:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R0833:Clip1	UTSW	5	123630721	missense	probably benign	0.05
R1116:Clip1	UTSW	5	123579491	missense	probably damaging	0.99
R1182:Clip1	UTSW	5	123647865	missense	probably damaging	1.00
R1656:Clip1	UTSW	5	123630403	missense	possibly damaging	0.61
R1700:Clip1	UTSW	5	123630370	missense	probably benign
R1889:Clip1	UTSW	5	123653496	missense	probably damaging	0.99
R1975:Clip1	UTSW	5	123623218	missense	possibly damaging	0.79
R2406:Clip1	UTSW	5	123603660	missense	probably damaging	1.00
R3545:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3547:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3548:Clip1	UTSW	5	123631078	missense	probably damaging	1.00
R3911:Clip1	UTSW	5	123590834	missense	probably damaging	1.00
R3944:Clip1	UTSW	5	123617829	unclassified	probably benign
R4660:Clip1	UTSW	5	123579374	missense	probably damaging	0.98
R4784:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4785:Clip1	UTSW	5	123579293	missense	probably damaging	1.00
R4824:Clip1	UTSW	5	123631023	missense	probably damaging	1.00
R4831:Clip1	UTSW	5	123583601	missense	probably damaging	1.00
R4951:Clip1	UTSW	5	123630345	missense	probably benign	0.02
R4960:Clip1	UTSW	5	123654003	nonsense	probably null
R5014:Clip1	UTSW	5	123617730	missense	probably damaging	0.99
R5116:Clip1	UTSW	5	123630707	missense	probably benign	0.05
R5212:Clip1	UTSW	5	123630681	missense	probably benign	0.09
R5238:Clip1	UTSW	5	123647883	missense	probably damaging	1.00
R5318:Clip1	UTSW	5	123613084	unclassified	probably benign
R5372:Clip1	UTSW	5	123630240	missense	probably benign	0.02
R5701:Clip1	UTSW	5	123613303	unclassified	probably benign
R5734:Clip1	UTSW	5	123615154	unclassified	probably benign
R5757:Clip1	UTSW	5	123627397	missense	probably benign	0.21
R6024:Clip1	UTSW	5	123615089	missense	possibly damaging	0.66
R6160:Clip1	UTSW	5	123613541	missense	possibly damaging	0.66
R6177:Clip1	UTSW	5	123613834	unclassified	probably benign
R6183:Clip1	UTSW	5	123642604	missense	probably damaging	1.00
R6377:Clip1	UTSW	5	123603654	missense	possibly damaging	0.50
R6436:Clip1	UTSW	5	123641785	missense	probably damaging	1.00
R6471:Clip1	UTSW	5	123640549	missense	probably damaging	0.99
R6766:Clip1	UTSW	5	123614764	unclassified	probably benign
R7094:Clip1	UTSW	5	123623270	missense	probably benign	0.02
R7143:Clip1	UTSW	5	123653610	missense	probably benign
R7222:Clip1	UTSW	5	123611841	missense	probably damaging	0.99
R7233:Clip1	UTSW	5	123611859	missense	probably damaging	1.00
R7238:Clip1	UTSW	5	123613265	missense
R7249:Clip1	UTSW	5	123603600	missense	probably damaging	1.00
R7283:Clip1	UTSW	5	123613794	missense
R7295:Clip1	UTSW	5	123627356	missense	probably benign	0.19
R7447:Clip1	UTSW	5	123653633	missense	probably benign	0.03
R7458:Clip1	UTSW	5	123640546	missense	probably damaging	1.00
R7483:Clip1	UTSW	5	123617384	missense	probably benign	0.00
R7516:Clip1	UTSW	5	123583385	missense	probably benign	0.00
R7619:Clip1	UTSW	5	123614279	missense
R7831:Clip1	UTSW	5	123613279	missense
R7897:Clip1	UTSW	5	123622798	missense	probably benign
R8155:Clip1	UTSW	5	123613636	missense
R8157:Clip1	UTSW	5	123630719	missense	probably benign	0.17
R8232:Clip1	UTSW	5	123647918	missense	probably benign	0.05
R8396:Clip1	UTSW	5	123642564	missense	probably damaging	1.00
R8446:Clip1	UTSW	5	123655945	missense	probably damaging	1.00
R8486:Clip1	UTSW	5	123614707	unclassified	probably benign
R8511:Clip1	UTSW	5	123653906	missense	possibly damaging	0.50
R8731:Clip1	UTSW	5	123614693	missense
R8889:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R8892:Clip1	UTSW	5	123579502	missense	probably benign	0.00
R9058:Clip1	UTSW	5	123614582	missense
R9106:Clip1	UTSW	5	123615160	missense	probably damaging	0.97
R9212:Clip1	UTSW	5	123583336	missense	probably damaging	1.00
R9217:Clip1	UTSW	5	123579378	missense	probably damaging	1.00
R9223:Clip1	UTSW	5	123646274	missense	probably damaging	1.00
R9325:Clip1	UTSW	5	123613123	missense
R9752:Clip1	UTSW	5	123621946	missense	probably damaging	1.00
Z1177:Clip1	UTSW	5	123617350	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CAACTTGGACTTGGAAAGGGC -3'
(R):5'- CTGAGCTGAAGACCTGTTGC -3'

Sequencing Primer
(F):5'- CTTGGAAAGGGCAGCGAAGTC -3'
(R):5'- CCTGTTGCTGCGAGAAGAAC -3'

Posted On

2019-05-13