Incidental Mutation 'R7015:Aplf'
ID545247
Institutional Source Beutler Lab
Gene Symbol Aplf
Ensembl Gene ENSMUSG00000030051
Gene Nameaprataxin and PNKP like factor
Synonyms2010301N04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R7015 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location87628424-87672193 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 87641902 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 399 (A399V)
Ref Sequence ENSEMBL: ENSMUSP00000066232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032130] [ENSMUST00000065997] [ENSMUST00000203209]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032130
AA Change: A420V

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032130
Gene: ENSMUSG00000030051
AA Change: A420V

DomainStartEndE-ValueType
SCOP:d1lgpa_ 6 105 2e-11 SMART
low complexity region 264 278 N/A INTRINSIC
low complexity region 340 349 N/A INTRINSIC
Pfam:zf-CCHH 372 396 1.7e-16 PFAM
Pfam:zf-CCHH 414 437 6.8e-15 PFAM
low complexity region 456 471 N/A INTRINSIC
low complexity region 477 486 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000065997
AA Change: A399V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066232
Gene: ENSMUSG00000030051
AA Change: A399V

DomainStartEndE-ValueType
SCOP:d1lgpa_ 14 84 7e-6 SMART
low complexity region 243 257 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
Pfam:zf-CCHH 351 376 1.7e-15 PFAM
Pfam:zf-CCHH 393 417 1.9e-15 PFAM
low complexity region 435 450 N/A INTRINSIC
low complexity region 456 465 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203209
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2ORF13 is a component of the cellular response to chromosomal DNA single- and double-strand breaks (Iles et al., 2007 [PubMed 17353262]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased repair of gamma irradiation-induced DNA damage and increased microhomology at class switch recombination junctions in B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A G 1: 160,075,168 R3G possibly damaging Het
Abcc2 A G 19: 43,798,178 I150V probably benign Het
Adgrb1 T C 15: 74,574,110 L1085P probably damaging Het
Agbl4 A G 4: 110,478,500 N24D probably damaging Het
Aox2 A G 1: 58,282,758 T70A probably benign Het
Asxl3 A G 18: 22,523,921 S1663G probably benign Het
Bcat1 G C 6: 145,039,583 P43R probably damaging Het
Camk1 T C 6: 113,341,926 R9G probably benign Het
Casp8ap2 T C 4: 32,644,278 V1117A probably damaging Het
Cd300ld4 A T 11: 115,022,707 V174E probably benign Het
Cep85l T C 10: 53,349,055 D146G possibly damaging Het
Clip1 T C 5: 123,613,612 probably benign Het
Cog3 C T 14: 75,713,276 V719I possibly damaging Het
Col4a4 G A 1: 82,506,950 P532L unknown Het
Col6a4 C T 9: 106,033,755 probably null Het
Dync1h1 C T 12: 110,666,087 Q4547* probably null Het
Ergic1 G A 17: 26,654,879 probably benign Het
Foxn4 G A 5: 114,256,855 T337M possibly damaging Het
Gemin5 A T 11: 58,156,740 I336N probably damaging Het
Gm21905 A T 5: 67,946,362 probably null Het
Grik2 C A 10: 49,535,436 R202L probably damaging Het
Iglon5 T C 7: 43,476,927 D184G probably benign Het
Il11ra1 A T 4: 41,765,421 Q172L probably benign Het
Me2 G T 18: 73,781,147 probably null Het
Med24 A G 11: 98,718,852 V73A possibly damaging Het
Mmp24 A G 2: 155,792,624 Q88R probably damaging Het
Mroh3 A T 1: 136,183,331 V819E probably damaging Het
Mrps9 A G 1: 42,898,546 K247R probably benign Het
Myo15b G A 11: 115,871,844 R1254H Het
Ncoa5 A G 2: 165,002,081 L134P probably benign Het
Olfr628 T C 7: 103,732,817 V297A probably null Het
Olfr78 C A 7: 102,742,444 L186F probably damaging Het
Olfr984 A T 9: 40,101,455 F12I probably benign Het
Pdcd11 A G 19: 47,098,226 I224V probably benign Het
Ptprh C A 7: 4,552,627 probably null Het
Rab34 G T 11: 78,190,152 V63F probably damaging Het
Rack1 T C 11: 48,801,765 I71T probably benign Het
Rai14 G A 15: 10,589,315 R266* probably null Het
Rsph9 A G 17: 46,129,456 V238A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sel1l3 A T 5: 53,172,574 C480S probably benign Het
Sh3pxd2a C T 19: 47,268,123 A747T probably benign Het
Slc1a3 T C 15: 8,649,568 N181S probably damaging Het
Slit1 T A 19: 41,629,886 K784* probably null Het
Sos2 T A 12: 69,585,235 Q1297L probably benign Het
Srd5a2 T A 17: 74,027,119 T102S probably benign Het
Ss18l2 A T 9: 121,712,608 I64F probably damaging Het
Tas2r120 T C 6: 132,657,165 F70S possibly damaging Het
Tjap1 G A 17: 46,263,774 A5V possibly damaging Het
Tln2 A T 9: 67,362,647 M488K possibly damaging Het
Tnks T G 8: 34,838,547 I42L probably benign Het
Togaram2 A T 17: 71,709,568 Q640L possibly damaging Het
Triobp C A 15: 78,994,060 Q1682K probably damaging Het
Trip11 C T 12: 101,893,683 E311K probably damaging Het
Ugt2b5 A G 5: 87,139,796 Y171H probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Zfp990 G T 4: 145,536,635 D68Y probably damaging Het
Zranb2 A T 3: 157,536,733 probably null Het
Other mutations in Aplf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Aplf APN 6 87668408 splice site probably benign
IGL01304:Aplf APN 6 87641900 missense possibly damaging 0.71
IGL02267:Aplf APN 6 87658964 missense probably damaging 1.00
R0294:Aplf UTSW 6 87646245 missense probably benign 0.02
R0352:Aplf UTSW 6 87653884 missense probably benign 0.01
R0445:Aplf UTSW 6 87663752 missense probably damaging 1.00
R0959:Aplf UTSW 6 87646083 missense probably benign 0.24
R1127:Aplf UTSW 6 87646291 missense probably benign 0.00
R1583:Aplf UTSW 6 87646033 missense probably damaging 1.00
R2878:Aplf UTSW 6 87668427 nonsense probably null
R3617:Aplf UTSW 6 87671883 missense possibly damaging 0.85
R4708:Aplf UTSW 6 87663757 missense probably damaging 1.00
R4823:Aplf UTSW 6 87646255 missense probably damaging 1.00
R4919:Aplf UTSW 6 87630064 missense possibly damaging 0.94
R4941:Aplf UTSW 6 87668423 missense probably damaging 1.00
R4941:Aplf UTSW 6 87646349 missense probably benign 0.00
R5208:Aplf UTSW 6 87642026 splice site probably null
R5575:Aplf UTSW 6 87646147 missense probably benign 0.02
R6271:Aplf UTSW 6 87646248 missense possibly damaging 0.88
R6381:Aplf UTSW 6 87658977 missense probably damaging 0.96
R6772:Aplf UTSW 6 87663799 missense possibly damaging 0.76
R6906:Aplf UTSW 6 87630086 missense possibly damaging 0.65
R6975:Aplf UTSW 6 87646086 missense probably damaging 0.98
R7038:Aplf UTSW 6 87653823 nonsense probably null
R7296:Aplf UTSW 6 87646215 missense probably damaging 0.99
R7778:Aplf UTSW 6 87658202 splice site probably null
R8259:Aplf UTSW 6 87630005 missense probably benign 0.23
R8260:Aplf UTSW 6 87630005 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATCACACCTCAGAGTCTTCATAG -3'
(R):5'- AAGATACTGGTTGGCCTCGC -3'

Sequencing Primer
(F):5'- ACCTCAGAGTCTTCATAGAACATG -3'
(R):5'- TGGTTGGCCTCGCTCACAG -3'
Posted On2019-05-13