Mutagenetix > Incidental Mutations

Incidental Mutation 'R7015:Aplf'

545247

Institutional Source

Beutler Lab

Gene Symbol

Aplf

Ensembl Gene

ENSMUSG00000030051

Gene Name

aprataxin and PNKP like factor

Synonyms

2010301N04Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R7015 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

87628424-87672193 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 87641902 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 399 (A399V)

Ref Sequence

ENSEMBL: ENSMUSP00000066232 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032130] [ENSMUST00000065997] [ENSMUST00000203209]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032130
AA Change: A420V

PolyPhen 2 Score 0.749 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000032130
Gene: ENSMUSG00000030051
AA Change: A420V

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	6	105	2e-11	SMART
low complexity region	264	278	N/A	INTRINSIC
low complexity region	340	349	N/A	INTRINSIC
Pfam:zf-CCHH	372	396	1.7e-16	PFAM
Pfam:zf-CCHH	414	437	6.8e-15	PFAM
low complexity region	456	471	N/A	INTRINSIC
low complexity region	477	486	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000065997
AA Change: A399V

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000066232
Gene: ENSMUSG00000030051
AA Change: A399V

Domain	Start	End	E-Value	Type
SCOP:d1lgpa_	14	84	7e-6	SMART
low complexity region	243	257	N/A	INTRINSIC
low complexity region	319	328	N/A	INTRINSIC
Pfam:zf-CCHH	351	376	1.7e-15	PFAM
Pfam:zf-CCHH	393	417	1.9e-15	PFAM
low complexity region	435	450	N/A	INTRINSIC
low complexity region	456	465	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000203209

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

93% (55/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] C2ORF13 is a component of the cellular response to chromosomal DNA single- and double-strand breaks (Iles et al., 2007 [PubMed 17353262]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit decreased repair of gamma irradiation-induced DNA damage and increased microhomology at class switch recombination junctions in B cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	A	G	1: 160,075,168	R3G	possibly damaging	Het
Abcc2	A	G	19: 43,798,178	I150V	probably benign	Het
Adgrb1	T	C	15: 74,574,110	L1085P	probably damaging	Het
Agbl4	A	G	4: 110,478,500	N24D	probably damaging	Het
Aox2	A	G	1: 58,282,758	T70A	probably benign	Het
Asxl3	A	G	18: 22,523,921	S1663G	probably benign	Het
Bcat1	G	C	6: 145,039,583	P43R	probably damaging	Het
Camk1	T	C	6: 113,341,926	R9G	probably benign	Het
Casp8ap2	T	C	4: 32,644,278	V1117A	probably damaging	Het
Cd300ld4	A	T	11: 115,022,707	V174E	probably benign	Het
Cep85l	T	C	10: 53,349,055	D146G	possibly damaging	Het
Clip1	T	C	5: 123,613,612		probably benign	Het
Cog3	C	T	14: 75,713,276	V719I	possibly damaging	Het
Col4a4	G	A	1: 82,506,950	P532L	unknown	Het
Col6a4	C	T	9: 106,033,755		probably null	Het
Dync1h1	C	T	12: 110,666,087	Q4547*	probably null	Het
Ergic1	G	A	17: 26,654,879		probably benign	Het
Foxn4	G	A	5: 114,256,855	T337M	possibly damaging	Het
Gemin5	A	T	11: 58,156,740	I336N	probably damaging	Het
Gm21905	A	T	5: 67,946,362		probably null	Het
Grik2	C	A	10: 49,535,436	R202L	probably damaging	Het
Iglon5	T	C	7: 43,476,927	D184G	probably benign	Het
Il11ra1	A	T	4: 41,765,421	Q172L	probably benign	Het
Me2	G	T	18: 73,781,147		probably null	Het
Med24	A	G	11: 98,718,852	V73A	possibly damaging	Het
Mmp24	A	G	2: 155,792,624	Q88R	probably damaging	Het
Mroh3	A	T	1: 136,183,331	V819E	probably damaging	Het
Mrps9	A	G	1: 42,898,546	K247R	probably benign	Het
Myo15b	G	A	11: 115,871,844	R1254H		Het
Ncoa5	A	G	2: 165,002,081	L134P	probably benign	Het
Olfr628	T	C	7: 103,732,817	V297A	probably null	Het
Olfr78	C	A	7: 102,742,444	L186F	probably damaging	Het
Olfr984	A	T	9: 40,101,455	F12I	probably benign	Het
Pdcd11	A	G	19: 47,098,226	I224V	probably benign	Het
Ptprh	C	A	7: 4,552,627		probably null	Het
Rab34	G	T	11: 78,190,152	V63F	probably damaging	Het
Rack1	T	C	11: 48,801,765	I71T	probably benign	Het
Rai14	G	A	15: 10,589,315	R266*	probably null	Het
Rsph9	A	G	17: 46,129,456	V238A	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Sel1l3	A	T	5: 53,172,574	C480S	probably benign	Het
Sh3pxd2a	C	T	19: 47,268,123	A747T	probably benign	Het
Slc1a3	T	C	15: 8,649,568	N181S	probably damaging	Het
Slit1	T	A	19: 41,629,886	K784*	probably null	Het
Sos2	T	A	12: 69,585,235	Q1297L	probably benign	Het
Srd5a2	T	A	17: 74,027,119	T102S	probably benign	Het
Ss18l2	A	T	9: 121,712,608	I64F	probably damaging	Het
Tas2r120	T	C	6: 132,657,165	F70S	possibly damaging	Het
Tjap1	G	A	17: 46,263,774	A5V	possibly damaging	Het
Tln2	A	T	9: 67,362,647	M488K	possibly damaging	Het
Tnks	T	G	8: 34,838,547	I42L	probably benign	Het
Togaram2	A	T	17: 71,709,568	Q640L	possibly damaging	Het
Triobp	C	A	15: 78,994,060	Q1682K	probably damaging	Het
Trip11	C	T	12: 101,893,683	E311K	probably damaging	Het
Ugt2b5	A	G	5: 87,139,796	Y171H	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Zfp990	G	T	4: 145,536,635	D68Y	probably damaging	Het
Zranb2	A	T	3: 157,536,733		probably null	Het

Other mutations in Aplf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00514:Aplf	APN	6	87668408	splice site	probably benign
IGL01304:Aplf	APN	6	87641900	missense	possibly damaging	0.71
IGL02267:Aplf	APN	6	87658964	missense	probably damaging	1.00
R0294:Aplf	UTSW	6	87646245	missense	probably benign	0.02
R0352:Aplf	UTSW	6	87653884	missense	probably benign	0.01
R0445:Aplf	UTSW	6	87663752	missense	probably damaging	1.00
R0959:Aplf	UTSW	6	87646083	missense	probably benign	0.24
R1127:Aplf	UTSW	6	87646291	missense	probably benign	0.00
R1583:Aplf	UTSW	6	87646033	missense	probably damaging	1.00
R2878:Aplf	UTSW	6	87668427	nonsense	probably null
R3617:Aplf	UTSW	6	87671883	missense	possibly damaging	0.85
R4708:Aplf	UTSW	6	87663757	missense	probably damaging	1.00
R4823:Aplf	UTSW	6	87646255	missense	probably damaging	1.00
R4919:Aplf	UTSW	6	87630064	missense	possibly damaging	0.94
R4941:Aplf	UTSW	6	87668423	missense	probably damaging	1.00
R4941:Aplf	UTSW	6	87646349	missense	probably benign	0.00
R5208:Aplf	UTSW	6	87642026	splice site	probably null
R5575:Aplf	UTSW	6	87646147	missense	probably benign	0.02
R6271:Aplf	UTSW	6	87646248	missense	possibly damaging	0.88
R6381:Aplf	UTSW	6	87658977	missense	probably damaging	0.96
R6772:Aplf	UTSW	6	87663799	missense	possibly damaging	0.76
R6906:Aplf	UTSW	6	87630086	missense	possibly damaging	0.65
R6975:Aplf	UTSW	6	87646086	missense	probably damaging	0.98
R7038:Aplf	UTSW	6	87653823	nonsense	probably null
R7296:Aplf	UTSW	6	87646215	missense	probably damaging	0.99
R7778:Aplf	UTSW	6	87658202	splice site	probably null
R8259:Aplf	UTSW	6	87630005	missense	probably benign	0.23
R8260:Aplf	UTSW	6	87630005	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- ATCACACCTCAGAGTCTTCATAG -3'
(R):5'- AAGATACTGGTTGGCCTCGC -3'

Sequencing Primer
(F):5'- ACCTCAGAGTCTTCATAGAACATG -3'
(R):5'- TGGTTGGCCTCGCTCACAG -3'

Posted On

2019-05-13