Incidental Mutation 'R7015:Olfr78'
ID545254
Institutional Source Beutler Lab
Gene Symbol Olfr78
Ensembl Gene ENSMUSG00000043366
Gene Nameolfactory receptor 78
SynonymsMOL2.3, GA_x6K02T2PBJ9-5459657-5458695, 4633402A21Rik, RA1c, MOR18-2, PSGR
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R7015 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102738511-102759471 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 102742444 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 186 (L186F)
Ref Sequence ENSEMBL: ENSMUSP00000149274 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060187] [ENSMUST00000168007] [ENSMUST00000217123]
Predicted Effect probably damaging
Transcript: ENSMUST00000060187
AA Change: L186F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058085
Gene: ENSMUSG00000043366
AA Change: L186F

DomainStartEndE-ValueType
Pfam:7tm_4 30 309 1.9e-111 PFAM
Pfam:7TM_GPCR_Srsx 34 252 1.4e-8 PFAM
Pfam:7tm_1 40 291 2.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168007
AA Change: L186F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133255
Gene: ENSMUSG00000043366
AA Change: L186F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 34 252 1.4e-8 PFAM
Pfam:7tm_1 40 291 1.4e-25 PFAM
Pfam:7tm_4 140 284 2.8e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217123
AA Change: L186F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to alterations in olfactory sensory neuron development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A G 1: 160,075,168 R3G possibly damaging Het
Abcc2 A G 19: 43,798,178 I150V probably benign Het
Adgrb1 T C 15: 74,574,110 L1085P probably damaging Het
Agbl4 A G 4: 110,478,500 N24D probably damaging Het
Aox2 A G 1: 58,282,758 T70A probably benign Het
Aplf G A 6: 87,641,902 A399V probably damaging Het
Asxl3 A G 18: 22,523,921 S1663G probably benign Het
Bcat1 G C 6: 145,039,583 P43R probably damaging Het
Camk1 T C 6: 113,341,926 R9G probably benign Het
Casp8ap2 T C 4: 32,644,278 V1117A probably damaging Het
Cd300ld4 A T 11: 115,022,707 V174E probably benign Het
Cep85l T C 10: 53,349,055 D146G possibly damaging Het
Clip1 T C 5: 123,613,612 probably benign Het
Cog3 C T 14: 75,713,276 V719I possibly damaging Het
Col4a4 G A 1: 82,506,950 P532L unknown Het
Col6a4 C T 9: 106,033,755 probably null Het
Dync1h1 C T 12: 110,666,087 Q4547* probably null Het
Ergic1 G A 17: 26,654,879 probably benign Het
Foxn4 G A 5: 114,256,855 T337M possibly damaging Het
Gemin5 A T 11: 58,156,740 I336N probably damaging Het
Gm21905 A T 5: 67,946,362 probably null Het
Grik2 C A 10: 49,535,436 R202L probably damaging Het
Iglon5 T C 7: 43,476,927 D184G probably benign Het
Il11ra1 A T 4: 41,765,421 Q172L probably benign Het
Me2 G T 18: 73,781,147 probably null Het
Med24 A G 11: 98,718,852 V73A possibly damaging Het
Mmp24 A G 2: 155,792,624 Q88R probably damaging Het
Mroh3 A T 1: 136,183,331 V819E probably damaging Het
Mrps9 A G 1: 42,898,546 K247R probably benign Het
Myo15b G A 11: 115,871,844 R1254H Het
Ncoa5 A G 2: 165,002,081 L134P probably benign Het
Olfr628 T C 7: 103,732,817 V297A probably null Het
Olfr984 A T 9: 40,101,455 F12I probably benign Het
Pdcd11 A G 19: 47,098,226 I224V probably benign Het
Ptprh C A 7: 4,552,627 probably null Het
Rab34 G T 11: 78,190,152 V63F probably damaging Het
Rack1 T C 11: 48,801,765 I71T probably benign Het
Rai14 G A 15: 10,589,315 R266* probably null Het
Rsph9 A G 17: 46,129,456 V238A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sel1l3 A T 5: 53,172,574 C480S probably benign Het
Sh3pxd2a C T 19: 47,268,123 A747T probably benign Het
Slc1a3 T C 15: 8,649,568 N181S probably damaging Het
Slit1 T A 19: 41,629,886 K784* probably null Het
Sos2 T A 12: 69,585,235 Q1297L probably benign Het
Srd5a2 T A 17: 74,027,119 T102S probably benign Het
Ss18l2 A T 9: 121,712,608 I64F probably damaging Het
Tas2r120 T C 6: 132,657,165 F70S possibly damaging Het
Tjap1 G A 17: 46,263,774 A5V possibly damaging Het
Tln2 A T 9: 67,362,647 M488K possibly damaging Het
Tnks T G 8: 34,838,547 I42L probably benign Het
Togaram2 A T 17: 71,709,568 Q640L possibly damaging Het
Triobp C A 15: 78,994,060 Q1682K probably damaging Het
Trip11 C T 12: 101,893,683 E311K probably damaging Het
Ugt2b5 A G 5: 87,139,796 Y171H probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Zfp990 G T 4: 145,536,635 D68Y probably damaging Het
Zranb2 A T 3: 157,536,733 probably null Het
Other mutations in Olfr78
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Olfr78 APN 7 102742262 missense probably damaging 1.00
IGL02071:Olfr78 APN 7 102742148 missense probably damaging 1.00
IGL03166:Olfr78 APN 7 102742047 missense probably benign 0.00
R0415:Olfr78 UTSW 7 102742087 missense probably benign 0.02
R0781:Olfr78 UTSW 7 102743007 utr 5 prime probably benign
R1676:Olfr78 UTSW 7 102742398 missense probably damaging 1.00
R1858:Olfr78 UTSW 7 102742364 missense probably damaging 1.00
R2391:Olfr78 UTSW 7 102742374 missense possibly damaging 0.63
R4542:Olfr78 UTSW 7 102742643 missense probably damaging 1.00
R4671:Olfr78 UTSW 7 102742601 missense probably damaging 0.98
R5400:Olfr78 UTSW 7 102742430 missense probably benign 0.00
R7133:Olfr78 UTSW 7 102742317 missense probably damaging 1.00
R7247:Olfr78 UTSW 7 102742344 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGTACATAGAAAGCCAGGACC -3'
(R):5'- TGAATCTACTATCCTGCTGGCC -3'

Sequencing Primer
(F):5'- TAGAAAGCCAGGACCACACTAATG -3'
(R):5'- CATGGCCTTTGACCGGTAC -3'
Posted On2019-05-13