Incidental Mutation 'R7015:Tnks'
ID545256
Institutional Source Beutler Lab
Gene Symbol Tnks
Ensembl Gene ENSMUSG00000031529
Gene Nametankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
SynonymsmTNKS1, 4930554K12Rik, D130072O21Rik, TANK1, tankyrase 1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7015 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location34826460-34965690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 34838547 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 42 (I42L)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033929]
Predicted Effect probably benign
Transcript: ENSMUST00000033929
AA Change: I1186L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033929
Gene: ENSMUSG00000031529
AA Change: I1186L

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
low complexity region 20 55 N/A INTRINSIC
low complexity region 68 86 N/A INTRINSIC
low complexity region 91 175 N/A INTRINSIC
ANK 208 237 4.26e-4 SMART
ANK 241 270 3.23e-4 SMART
ANK 274 303 3.28e-5 SMART
ANK 327 355 2.66e3 SMART
ANK 361 390 7.64e-6 SMART
ANK 394 423 2.62e-4 SMART
ANK 427 456 1.99e-4 SMART
ANK 514 546 3.18e-3 SMART
ANK 550 579 1.51e-4 SMART
ANK 583 612 4.26e-4 SMART
ANK 642 670 2.21e3 SMART
ANK 676 705 4.03e-5 SMART
ANK 709 738 2.48e-5 SMART
ANK 742 771 1.64e-5 SMART
low complexity region 792 810 N/A INTRINSIC
ANK 829 858 1.47e-7 SMART
ANK 862 891 2.21e-2 SMART
ANK 895 924 3.13e-2 SMART
low complexity region 996 1010 N/A INTRINSIC
SAM 1017 1082 1.14e-12 SMART
Pfam:PARP 1098 1303 1.5e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209632
Predicted Effect probably benign
Transcript: ENSMUST00000210014
AA Change: I42L

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 93% (55/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele fail to exhibit any abonormalities. Male mice homozygous for a gene trapped allele exhibit decreased fat pad weight, increased metabolism, hyperinsulinemia, and hypoglycemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A G 1: 160,075,168 R3G possibly damaging Het
Abcc2 A G 19: 43,798,178 I150V probably benign Het
Adgrb1 T C 15: 74,574,110 L1085P probably damaging Het
Agbl4 A G 4: 110,478,500 N24D probably damaging Het
Aox2 A G 1: 58,282,758 T70A probably benign Het
Aplf G A 6: 87,641,902 A399V probably damaging Het
Asxl3 A G 18: 22,523,921 S1663G probably benign Het
Bcat1 G C 6: 145,039,583 P43R probably damaging Het
Camk1 T C 6: 113,341,926 R9G probably benign Het
Casp8ap2 T C 4: 32,644,278 V1117A probably damaging Het
Cd300ld4 A T 11: 115,022,707 V174E probably benign Het
Cep85l T C 10: 53,349,055 D146G possibly damaging Het
Clip1 T C 5: 123,613,612 probably benign Het
Cog3 C T 14: 75,713,276 V719I possibly damaging Het
Col4a4 G A 1: 82,506,950 P532L unknown Het
Col6a4 C T 9: 106,033,755 probably null Het
Dync1h1 C T 12: 110,666,087 Q4547* probably null Het
Ergic1 G A 17: 26,654,879 probably benign Het
Foxn4 G A 5: 114,256,855 T337M possibly damaging Het
Gemin5 A T 11: 58,156,740 I336N probably damaging Het
Gm21905 A T 5: 67,946,362 probably null Het
Grik2 C A 10: 49,535,436 R202L probably damaging Het
Iglon5 T C 7: 43,476,927 D184G probably benign Het
Il11ra1 A T 4: 41,765,421 Q172L probably benign Het
Me2 G T 18: 73,781,147 probably null Het
Med24 A G 11: 98,718,852 V73A possibly damaging Het
Mmp24 A G 2: 155,792,624 Q88R probably damaging Het
Mroh3 A T 1: 136,183,331 V819E probably damaging Het
Mrps9 A G 1: 42,898,546 K247R probably benign Het
Myo15b G A 11: 115,871,844 R1254H Het
Ncoa5 A G 2: 165,002,081 L134P probably benign Het
Olfr628 T C 7: 103,732,817 V297A probably null Het
Olfr78 C A 7: 102,742,444 L186F probably damaging Het
Olfr984 A T 9: 40,101,455 F12I probably benign Het
Pdcd11 A G 19: 47,098,226 I224V probably benign Het
Ptprh C A 7: 4,552,627 probably null Het
Rab34 G T 11: 78,190,152 V63F probably damaging Het
Rack1 T C 11: 48,801,765 I71T probably benign Het
Rai14 G A 15: 10,589,315 R266* probably null Het
Rsph9 A G 17: 46,129,456 V238A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sel1l3 A T 5: 53,172,574 C480S probably benign Het
Sh3pxd2a C T 19: 47,268,123 A747T probably benign Het
Slc1a3 T C 15: 8,649,568 N181S probably damaging Het
Slit1 T A 19: 41,629,886 K784* probably null Het
Sos2 T A 12: 69,585,235 Q1297L probably benign Het
Srd5a2 T A 17: 74,027,119 T102S probably benign Het
Ss18l2 A T 9: 121,712,608 I64F probably damaging Het
Tas2r120 T C 6: 132,657,165 F70S possibly damaging Het
Tjap1 G A 17: 46,263,774 A5V possibly damaging Het
Tln2 A T 9: 67,362,647 M488K possibly damaging Het
Togaram2 A T 17: 71,709,568 Q640L possibly damaging Het
Triobp C A 15: 78,994,060 Q1682K probably damaging Het
Trip11 C T 12: 101,893,683 E311K probably damaging Het
Ugt2b5 A G 5: 87,139,796 Y171H probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Zfp990 G T 4: 145,536,635 D68Y probably damaging Het
Zranb2 A T 3: 157,536,733 probably null Het
Other mutations in Tnks
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Tnks APN 8 34861689 splice site probably benign
IGL00901:Tnks APN 8 34838395 nonsense probably null
IGL01448:Tnks APN 8 34839982 missense probably damaging 1.00
IGL01455:Tnks APN 8 34940900 missense probably damaging 0.99
IGL01962:Tnks APN 8 34869524 missense probably damaging 1.00
IGL02088:Tnks APN 8 34839994 missense possibly damaging 0.50
IGL02260:Tnks APN 8 34842983 missense probably damaging 0.99
IGL02454:Tnks APN 8 34831728 unclassified probably benign
IGL02486:Tnks APN 8 34851198 missense probably damaging 1.00
IGL02612:Tnks APN 8 34849299 missense possibly damaging 0.48
IGL03179:Tnks APN 8 34848670 missense probably benign 0.38
IGL03404:Tnks APN 8 34940704 missense probably damaging 1.00
R0256:Tnks UTSW 8 34861547 missense probably benign 0.07
R0265:Tnks UTSW 8 34839970 nonsense probably null
R0334:Tnks UTSW 8 34853259 nonsense probably null
R0414:Tnks UTSW 8 34853309 missense probably damaging 1.00
R0526:Tnks UTSW 8 34853303 missense probably benign 0.23
R0622:Tnks UTSW 8 34940822 missense probably damaging 1.00
R1445:Tnks UTSW 8 34834603 splice site probably benign
R1618:Tnks UTSW 8 34875276 missense probably damaging 1.00
R1779:Tnks UTSW 8 34857518 missense probably benign 0.18
R1919:Tnks UTSW 8 34875232 missense probably damaging 1.00
R1938:Tnks UTSW 8 34838530 missense probably damaging 1.00
R2018:Tnks UTSW 8 34851106 missense probably damaging 1.00
R2198:Tnks UTSW 8 34848649 missense probably benign
R2198:Tnks UTSW 8 34873067 missense probably benign 0.29
R2925:Tnks UTSW 8 34965661 missense unknown
R3828:Tnks UTSW 8 34873178 missense probably damaging 1.00
R3913:Tnks UTSW 8 34873074 missense probably damaging 0.99
R3916:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3917:Tnks UTSW 8 34853361 missense probably damaging 1.00
R3930:Tnks UTSW 8 34940812 missense probably damaging 1.00
R4659:Tnks UTSW 8 34849311 missense possibly damaging 0.53
R4760:Tnks UTSW 8 34851783 missense probably benign 0.38
R5091:Tnks UTSW 8 34841809 missense probably benign 0.40
R5419:Tnks UTSW 8 34965566 missense unknown
R5558:Tnks UTSW 8 34965665 start codon destroyed probably null
R5582:Tnks UTSW 8 34940861 missense probably benign 0.14
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6035:Tnks UTSW 8 34918461 missense possibly damaging 0.93
R6495:Tnks UTSW 8 34839966 critical splice donor site probably null
R6527:Tnks UTSW 8 34873093 missense probably benign 0.36
R6991:Tnks UTSW 8 34834493 missense probably damaging 1.00
R7038:Tnks UTSW 8 34851636 missense probably damaging 0.99
R7057:Tnks UTSW 8 34840014 missense probably damaging 1.00
R7167:Tnks UTSW 8 34849304 missense probably damaging 0.98
R7250:Tnks UTSW 8 34851758 missense probably damaging 0.98
R7475:Tnks UTSW 8 34831712 missense probably damaging 1.00
R7790:Tnks UTSW 8 34861540 missense probably benign 0.01
R7818:Tnks UTSW 8 34873028 missense probably benign 0.03
R7909:Tnks UTSW 8 34940704 missense probably damaging 1.00
R7970:Tnks UTSW 8 34855926 critical splice donor site probably null
R8341:Tnks UTSW 8 34873045 missense probably damaging 1.00
R8343:Tnks UTSW 8 34834584 missense probably benign 0.03
Z1177:Tnks UTSW 8 34965145 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACCCAGCGCTATAGTCAAAGG -3'
(R):5'- GTCTGAATTTGCTGCTAAACTCC -3'

Sequencing Primer
(F):5'- CCAGCGCTATAGTCAAAGGTTAGTTG -3'
(R):5'- CTGCTAAACTCCAGTTCCAAGTTGAG -3'
Posted On2019-05-13