Incidental Mutation 'R7015:Gemin5'
ID545264
Institutional Source Beutler Lab
Gene Symbol Gemin5
Ensembl Gene ENSMUSG00000037275
Gene Namegem nuclear organelle associated protein 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7015 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58120002-58168539 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58156740 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 336 (I336N)
Ref Sequence ENSEMBL: ENSMUSP00000131842 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035604] [ENSMUST00000102711] [ENSMUST00000172035]
Predicted Effect probably damaging
Transcript: ENSMUST00000035604
AA Change: I336N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000036603
Gene: ENSMUSG00000037275
AA Change: I336N

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000102711
AA Change: I336N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099772
Gene: ENSMUSG00000037275
AA Change: I336N

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1063 1083 N/A INTRINSIC
low complexity region 1116 1131 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000116600
Gene: ENSMUSG00000037275
AA Change: I52N

DomainStartEndE-ValueType
Blast:WD40 2 29 7e-12 BLAST
WD40 33 82 1.99e0 SMART
WD40 85 125 5.15e-2 SMART
WD40 132 172 8.49e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000172035
AA Change: I336N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131842
Gene: ENSMUSG00000037275
AA Change: I336N

DomainStartEndE-ValueType
WD40 53 95 1.47e-6 SMART
WD40 98 138 6.19e-1 SMART
WD40 141 180 1.54e0 SMART
WD40 184 255 2.45e-8 SMART
WD40 280 312 1.42e2 SMART
WD40 316 365 1.99e0 SMART
WD40 368 408 5.15e-2 SMART
WD40 415 455 8.49e-3 SMART
WD40 460 511 8.84e1 SMART
WD40 529 564 4.28e0 SMART
WD40 567 613 2.24e-2 SMART
WD40 628 668 2.2e-10 SMART
WD40 671 711 2.31e-4 SMART
low complexity region 731 754 N/A INTRINSIC
low complexity region 788 804 N/A INTRINSIC
low complexity region 813 844 N/A INTRINSIC
low complexity region 1064 1084 N/A INTRINSIC
low complexity region 1117 1132 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat protein that is a component of the survival of motor neurons (SMN) complex. The SMN complex plays a critical role in mRNA splicing through the assembly of spliceosomal small nuclear ribonucleoproteins (snRNPs), and may also mediate the assembly and transport of other classes of ribonucleoproteins. The encoded protein is the snRNA-binding component of the SMN complex. Dysregulation of this gene may play a role in alternative mRNA splicing and tumor cell motility. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A G 1: 160,075,168 R3G possibly damaging Het
Abcc2 A G 19: 43,798,178 I150V probably benign Het
Adgrb1 T C 15: 74,574,110 L1085P probably damaging Het
Agbl4 A G 4: 110,478,500 N24D probably damaging Het
Aox2 A G 1: 58,282,758 T70A probably benign Het
Aplf G A 6: 87,641,902 A399V probably damaging Het
Asxl3 A G 18: 22,523,921 S1663G probably benign Het
Bcat1 G C 6: 145,039,583 P43R probably damaging Het
Camk1 T C 6: 113,341,926 R9G probably benign Het
Casp8ap2 T C 4: 32,644,278 V1117A probably damaging Het
Cd300ld4 A T 11: 115,022,707 V174E probably benign Het
Cep85l T C 10: 53,349,055 D146G possibly damaging Het
Clip1 T C 5: 123,613,612 probably benign Het
Cog3 C T 14: 75,713,276 V719I possibly damaging Het
Col4a4 G A 1: 82,506,950 P532L unknown Het
Col6a4 C T 9: 106,033,755 probably null Het
Dync1h1 C T 12: 110,666,087 Q4547* probably null Het
Ergic1 G A 17: 26,654,879 probably benign Het
Foxn4 G A 5: 114,256,855 T337M possibly damaging Het
Gm21905 A T 5: 67,946,362 probably null Het
Grik2 C A 10: 49,535,436 R202L probably damaging Het
Iglon5 T C 7: 43,476,927 D184G probably benign Het
Il11ra1 A T 4: 41,765,421 Q172L probably benign Het
Me2 G T 18: 73,781,147 probably null Het
Med24 A G 11: 98,718,852 V73A possibly damaging Het
Mmp24 A G 2: 155,792,624 Q88R probably damaging Het
Mroh3 A T 1: 136,183,331 V819E probably damaging Het
Mrps9 A G 1: 42,898,546 K247R probably benign Het
Myo15b G A 11: 115,871,844 R1254H Het
Ncoa5 A G 2: 165,002,081 L134P probably benign Het
Olfr628 T C 7: 103,732,817 V297A probably null Het
Olfr78 C A 7: 102,742,444 L186F probably damaging Het
Olfr984 A T 9: 40,101,455 F12I probably benign Het
Pdcd11 A G 19: 47,098,226 I224V probably benign Het
Ptprh C A 7: 4,552,627 probably null Het
Rab34 G T 11: 78,190,152 V63F probably damaging Het
Rack1 T C 11: 48,801,765 I71T probably benign Het
Rai14 G A 15: 10,589,315 R266* probably null Het
Rsph9 A G 17: 46,129,456 V238A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sel1l3 A T 5: 53,172,574 C480S probably benign Het
Sh3pxd2a C T 19: 47,268,123 A747T probably benign Het
Slc1a3 T C 15: 8,649,568 N181S probably damaging Het
Slit1 T A 19: 41,629,886 K784* probably null Het
Sos2 T A 12: 69,585,235 Q1297L probably benign Het
Srd5a2 T A 17: 74,027,119 T102S probably benign Het
Ss18l2 A T 9: 121,712,608 I64F probably damaging Het
Tas2r120 T C 6: 132,657,165 F70S possibly damaging Het
Tjap1 G A 17: 46,263,774 A5V possibly damaging Het
Tln2 A T 9: 67,362,647 M488K possibly damaging Het
Tnks T G 8: 34,838,547 I42L probably benign Het
Togaram2 A T 17: 71,709,568 Q640L possibly damaging Het
Triobp C A 15: 78,994,060 Q1682K probably damaging Het
Trip11 C T 12: 101,893,683 E311K probably damaging Het
Ugt2b5 A G 5: 87,139,796 Y171H probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Zfp990 G T 4: 145,536,635 D68Y probably damaging Het
Zranb2 A T 3: 157,536,733 probably null Het
Other mutations in Gemin5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Gemin5 APN 11 58163817 missense probably damaging 1.00
IGL00540:Gemin5 APN 11 58160818 missense probably damaging 1.00
IGL01521:Gemin5 APN 11 58134918 splice site probably benign
IGL02190:Gemin5 APN 11 58134842 missense probably damaging 1.00
IGL02274:Gemin5 APN 11 58156795 missense possibly damaging 0.80
IGL02494:Gemin5 APN 11 58121757 missense probably benign 0.12
IGL02549:Gemin5 APN 11 58134803 missense probably damaging 1.00
IGL02740:Gemin5 APN 11 58151564 missense probably damaging 1.00
IGL02815:Gemin5 APN 11 58146409 missense probably damaging 1.00
IGL02823:Gemin5 APN 11 58167705 splice site probably benign
IGL02939:Gemin5 APN 11 58156730 missense probably damaging 1.00
Landscape UTSW 11 58163904 missense probably benign 0.16
R0101:Gemin5 UTSW 11 58145496 missense probably damaging 1.00
R0479:Gemin5 UTSW 11 58139551 missense probably benign 0.00
R1481:Gemin5 UTSW 11 58141654 missense probably damaging 1.00
R1642:Gemin5 UTSW 11 58139080 missense probably damaging 1.00
R1648:Gemin5 UTSW 11 58147979 nonsense probably null
R1980:Gemin5 UTSW 11 58136917 missense probably damaging 1.00
R3079:Gemin5 UTSW 11 58145519 missense probably damaging 1.00
R3418:Gemin5 UTSW 11 58156628 intron probably null
R4260:Gemin5 UTSW 11 58168359 missense probably damaging 0.99
R4396:Gemin5 UTSW 11 58139549 missense probably benign 0.05
R4902:Gemin5 UTSW 11 58164277 missense probably benign 0.18
R5178:Gemin5 UTSW 11 58146518 missense probably benign 0.01
R5296:Gemin5 UTSW 11 58130061 missense probably damaging 1.00
R5350:Gemin5 UTSW 11 58141586 critical splice donor site probably null
R5426:Gemin5 UTSW 11 58125287 missense probably benign 0.00
R5494:Gemin5 UTSW 11 58130700 missense probably damaging 1.00
R5744:Gemin5 UTSW 11 58155183 missense possibly damaging 0.88
R5889:Gemin5 UTSW 11 58122355 missense possibly damaging 0.76
R5984:Gemin5 UTSW 11 58156761 missense probably damaging 1.00
R6844:Gemin5 UTSW 11 58163904 missense probably benign 0.16
R6934:Gemin5 UTSW 11 58147912 missense probably damaging 1.00
R6999:Gemin5 UTSW 11 58125121 missense probably benign 0.00
R7144:Gemin5 UTSW 11 58141663 missense probably benign 0.30
R7176:Gemin5 UTSW 11 58166002 missense probably benign 0.05
R7540:Gemin5 UTSW 11 58130402 intron probably null
R7670:Gemin5 UTSW 11 58147928 missense probably benign 0.01
R7717:Gemin5 UTSW 11 58151530 critical splice donor site probably null
R7791:Gemin5 UTSW 11 58124993 missense probably benign 0.04
R8050:Gemin5 UTSW 11 58128860 missense probably benign 0.00
X0066:Gemin5 UTSW 11 58151535 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AGTGCACTTGCTAACAGGGG -3'
(R):5'- GCGCTAAGAAGAGGATTTAGTTTCTC -3'

Sequencing Primer
(F):5'- TTGCTAACAGGGGCCCGAAC -3'
(R):5'- AGAGGATTTAGTTTCTCTCTTGACC -3'
Posted On2019-05-13