Mutagenetix > Incidental Mutation

Incidental Mutation 'R7015:Adgrb1'

545274

Institutional Source

Beutler Lab

Gene Symbol

Adgrb1

Ensembl Gene

ENSMUSG00000034730

Gene Name

adhesion G protein-coupled receptor B1

Synonyms

Bai1, B830018M07Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7015 (G1)

Quality Score

216.009

Status

Validated

Chromosome

Chromosomal Location

74516195-74589465 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 74574110 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 1085 (L1085P)

Ref Sequence

ENSEMBL: ENSMUSP00000140362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000170845] [ENSMUST00000185682] [ENSMUST00000186360] [ENSMUST00000187485] [ENSMUST00000187599] [ENSMUST00000189353] [ENSMUST00000190524]

AlphaFold

Q3UHD1

Predicted Effect

probably damaging
Transcript: ENSMUST00000042035
AA Change: L1085P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: L1085P

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	4.69e-10	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	3.5e-9	SMART
TSP1	412	462	3.16e-16	SMART
TSP1	470	520	7.15e-15	SMART
TSP1	525	575	3.11e-15	SMART
HormR	577	643	2.55e-20	SMART
Pfam:GAIN	656	859	1e-46	PFAM
GPS	880	938	1.46e-18	SMART
Pfam:7tm_2	944	1180	3.3e-66	PFAM
SCOP:d1jvr__	1396	1432	5e-4	SMART
low complexity region	1441	1455	N/A	INTRINSIC
low complexity region	1545	1556	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000170845
AA Change: L145P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000127122
Gene: ENSMUSG00000034730
AA Change: L145P

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	240	1.9e-67	PFAM
SCOP:d1jvr__	456	492	1e-3	SMART
low complexity region	501	515	N/A	INTRINSIC
low complexity region	605	616	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000185682
AA Change: L145P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000139428
Gene: ENSMUSG00000034730
AA Change: L145P

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	240	1.9e-67	PFAM
SCOP:d1jvr__	456	492	1e-3	SMART
low complexity region	501	515	N/A	INTRINSIC
low complexity region	605	616	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000186360
AA Change: L1085P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: L1085P

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
TSP1	357	407	1.7e-11	SMART
TSP1	412	462	1.5e-18	SMART
TSP1	470	520	3.4e-17	SMART
TSP1	525	575	1.5e-17	SMART
HormR	577	643	1.6e-22	SMART
Pfam:DUF3497	653	874	1.2e-44	PFAM
GPS	880	938	8.9e-21	SMART
Pfam:7tm_2	944	1106	9.6e-43	PFAM
low complexity region	1113	1143	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187485

SMART Domains

Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
signal peptide	1	33	N/A	INTRINSIC
low complexity region	141	160	N/A	INTRINSIC
TSP1	264	315	2.2e-12	SMART
low complexity region	319	329	N/A	INTRINSIC
low complexity region	371	386	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000187599

SMART Domains

Protein: ENSMUSP00000140831
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	135	6.4e-37	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000189353
AA Change: L145P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000140889
Gene: ENSMUSG00000034730
AA Change: L145P

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	147	3.5e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000190524

SMART Domains

Protein: ENSMUSP00000140407
Gene: ENSMUSG00000034730

Domain	Start	End	E-Value	Type
Pfam:7tm_2	4	112	4.3e-27	PFAM

Meta Mutation Damage Score

0.7839

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

93% (55/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	A	G	1: 160,075,168	R3G	possibly damaging	Het
Abcc2	A	G	19: 43,798,178	I150V	probably benign	Het
Agbl4	A	G	4: 110,478,500	N24D	probably damaging	Het
Aox2	A	G	1: 58,282,758	T70A	probably benign	Het
Aplf	G	A	6: 87,641,902	A399V	probably damaging	Het
Asxl3	A	G	18: 22,523,921	S1663G	probably benign	Het
Bcat1	G	C	6: 145,039,583	P43R	probably damaging	Het
Camk1	T	C	6: 113,341,926	R9G	probably benign	Het
Casp8ap2	T	C	4: 32,644,278	V1117A	probably damaging	Het
Cd300ld4	A	T	11: 115,022,707	V174E	probably benign	Het
Cep85l	T	C	10: 53,349,055	D146G	possibly damaging	Het
Clip1	T	C	5: 123,613,612		probably benign	Het
Cog3	C	T	14: 75,713,276	V719I	possibly damaging	Het
Col4a4	G	A	1: 82,506,950	P532L	unknown	Het
Col6a4	C	T	9: 106,033,755		probably null	Het
Dync1h1	C	T	12: 110,666,087	Q4547*	probably null	Het
Ergic1	G	A	17: 26,654,879		probably benign	Het
Foxn4	G	A	5: 114,256,855	T337M	possibly damaging	Het
Gemin5	A	T	11: 58,156,740	I336N	probably damaging	Het
Gm21905	A	T	5: 67,946,362		probably null	Het
Grik2	C	A	10: 49,535,436	R202L	probably damaging	Het
Iglon5	T	C	7: 43,476,927	D184G	probably benign	Het
Il11ra1	A	T	4: 41,765,421	Q172L	probably benign	Het
Me2	G	T	18: 73,781,147		probably null	Het
Med24	A	G	11: 98,718,852	V73A	possibly damaging	Het
Mmp24	A	G	2: 155,792,624	Q88R	probably damaging	Het
Mroh3	A	T	1: 136,183,331	V819E	probably damaging	Het
Mrps9	A	G	1: 42,898,546	K247R	probably benign	Het
Myo15b	G	A	11: 115,871,844	R1254H		Het
Ncoa5	A	G	2: 165,002,081	L134P	probably benign	Het
Olfr628	T	C	7: 103,732,817	V297A	probably null	Het
Olfr78	C	A	7: 102,742,444	L186F	probably damaging	Het
Olfr984	A	T	9: 40,101,455	F12I	probably benign	Het
Pdcd11	A	G	19: 47,098,226	I224V	probably benign	Het
Ptprh	C	A	7: 4,552,627		probably null	Het
Rab34	G	T	11: 78,190,152	V63F	probably damaging	Het
Rack1	T	C	11: 48,801,765	I71T	probably benign	Het
Rai14	G	A	15: 10,589,315	R266*	probably null	Het
Rsph9	A	G	17: 46,129,456	V238A	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Sel1l3	A	T	5: 53,172,574	C480S	probably benign	Het
Sh3pxd2a	C	T	19: 47,268,123	A747T	probably benign	Het
Slc1a3	T	C	15: 8,649,568	N181S	probably damaging	Het
Slit1	T	A	19: 41,629,886	K784*	probably null	Het
Sos2	T	A	12: 69,585,235	Q1297L	probably benign	Het
Srd5a2	T	A	17: 74,027,119	T102S	probably benign	Het
Ss18l2	A	T	9: 121,712,608	I64F	probably damaging	Het
Tas2r120	T	C	6: 132,657,165	F70S	possibly damaging	Het
Tjap1	G	A	17: 46,263,774	A5V	possibly damaging	Het
Tln2	A	T	9: 67,362,647	M488K	possibly damaging	Het
Tnks	T	G	8: 34,838,547	I42L	probably benign	Het
Togaram2	A	T	17: 71,709,568	Q640L	possibly damaging	Het
Triobp	C	A	15: 78,994,060	Q1682K	probably damaging	Het
Trip11	C	T	12: 101,893,683	E311K	probably damaging	Het
Ugt2b5	A	G	5: 87,139,796	Y171H	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Zfp990	G	T	4: 145,536,635	D68Y	probably damaging	Het
Zranb2	A	T	3: 157,536,733		probably null	Het

Other mutations in Adgrb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01525:Adgrb1	APN	15	74586835	missense	probably damaging	1.00
IGL01748:Adgrb1	APN	15	74548357	splice site	probably benign
IGL01874:Adgrb1	APN	15	74541574	missense	possibly damaging	0.95
IGL02040:Adgrb1	APN	15	74541575	missense	possibly damaging	0.91
IGL02138:Adgrb1	APN	15	74529782	missense	probably damaging	1.00
IGL02149:Adgrb1	APN	15	74540477	missense	probably damaging	1.00
IGL02320:Adgrb1	APN	15	74574112	missense	probably damaging	1.00
IGL02556:Adgrb1	APN	15	74586805	missense	probably damaging	0.99
IGL02637:Adgrb1	APN	15	74588294	splice site	probably benign
IGL02678:Adgrb1	APN	15	74538328	missense	probably damaging	0.99
IGL02792:Adgrb1	APN	15	74547622	missense	probably damaging	0.98
Bunting	UTSW	15	74543701	missense	probably null	0.94
BB005:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
BB015:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
PIT4520001:Adgrb1	UTSW	15	74541659	missense	probably damaging	0.99
R0193:Adgrb1	UTSW	15	74572156	missense	probably damaging	1.00
R0208:Adgrb1	UTSW	15	74586807	missense	probably benign
R0267:Adgrb1	UTSW	15	74529389	missense	probably damaging	1.00
R0336:Adgrb1	UTSW	15	74587149	missense	probably benign	0.06
R0345:Adgrb1	UTSW	15	74543349	missense	probably damaging	0.97
R0533:Adgrb1	UTSW	15	74541559	missense	probably damaging	1.00
R0635:Adgrb1	UTSW	15	74540892	missense	possibly damaging	0.88
R0729:Adgrb1	UTSW	15	74548549	missense	probably damaging	1.00
R0792:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1122:Adgrb1	UTSW	15	74547685	missense	probably damaging	0.99
R1295:Adgrb1	UTSW	15	74550039	missense	probably damaging	1.00
R1522:Adgrb1	UTSW	15	74580617	missense	probably damaging	1.00
R1696:Adgrb1	UTSW	15	74588107	missense	probably damaging	1.00
R1707:Adgrb1	UTSW	15	74529343	missense	probably damaging	0.99
R1750:Adgrb1	UTSW	15	74541827	missense	probably benign	0.23
R1804:Adgrb1	UTSW	15	74529540	missense	probably damaging	1.00
R1829:Adgrb1	UTSW	15	74580586	nonsense	probably null
R1895:Adgrb1	UTSW	15	74540465	missense	probably damaging	1.00
R1970:Adgrb1	UTSW	15	74539877	splice site	probably benign
R2114:Adgrb1	UTSW	15	74540562	critical splice donor site	probably null
R2133:Adgrb1	UTSW	15	74529908	missense	probably damaging	1.00
R2210:Adgrb1	UTSW	15	74547704	missense	probably damaging	1.00
R3701:Adgrb1	UTSW	15	74545015	missense	probably damaging	0.99
R3770:Adgrb1	UTSW	15	74588308	missense	probably damaging	1.00
R3980:Adgrb1	UTSW	15	74582943	missense	probably damaging	1.00
R4355:Adgrb1	UTSW	15	74543662	missense	probably damaging	1.00
R4412:Adgrb1	UTSW	15	74577453	unclassified	probably benign
R4634:Adgrb1	UTSW	15	74584429	utr 3 prime	probably benign
R4683:Adgrb1	UTSW	15	74588114	missense	probably damaging	1.00
R4742:Adgrb1	UTSW	15	74529479	nonsense	probably null
R4760:Adgrb1	UTSW	15	74571463	missense	probably damaging	1.00
R4794:Adgrb1	UTSW	15	74588129	missense	probably damaging	1.00
R4880:Adgrb1	UTSW	15	74587022	missense	possibly damaging	0.85
R4885:Adgrb1	UTSW	15	74572162	missense	probably benign	0.04
R5092:Adgrb1	UTSW	15	74529815	missense	probably benign	0.39
R5198:Adgrb1	UTSW	15	74543701	missense	probably null	0.94
R5225:Adgrb1	UTSW	15	74577499	unclassified	probably benign
R5421:Adgrb1	UTSW	15	74550027	missense	probably damaging	1.00
R5764:Adgrb1	UTSW	15	74541574	missense	possibly damaging	0.95
R5914:Adgrb1	UTSW	15	74538370	missense	possibly damaging	0.54
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6035:Adgrb1	UTSW	15	74540443	missense	possibly damaging	0.50
R6066:Adgrb1	UTSW	15	74540459	missense	probably damaging	0.99
R6423:Adgrb1	UTSW	15	74588143	critical splice donor site	probably null
R6811:Adgrb1	UTSW	15	74529361	missense	probably damaging	1.00
R6945:Adgrb1	UTSW	15	74550024	missense	probably damaging	0.99
R7012:Adgrb1	UTSW	15	74529901	missense	probably damaging	0.97
R7061:Adgrb1	UTSW	15	74569881	missense	probably benign	0.00
R7209:Adgrb1	UTSW	15	74569948	missense	possibly damaging	0.85
R7213:Adgrb1	UTSW	15	74569884	missense	probably benign
R7283:Adgrb1	UTSW	15	74580663	missense	possibly damaging	0.94
R7329:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R7616:Adgrb1	UTSW	15	74548569	missense	probably damaging	0.98
R7695:Adgrb1	UTSW	15	74543638	missense	possibly damaging	0.95
R7928:Adgrb1	UTSW	15	74538321	missense	probably damaging	1.00
R8152:Adgrb1	UTSW	15	74541611	missense	probably benign	0.00
R8152:Adgrb1	UTSW	15	74545000	missense	probably damaging	0.98
R8198:Adgrb1	UTSW	15	74539245	missense	probably damaging	0.99
R8485:Adgrb1	UTSW	15	74548304	missense	probably damaging	1.00
R8528:Adgrb1	UTSW	15	74575851	missense	possibly damaging	0.51
R8534:Adgrb1	UTSW	15	74543508	missense	probably damaging	0.97
R8865:Adgrb1	UTSW	15	74543658	missense	possibly damaging	0.75
R9044:Adgrb1	UTSW	15	74569899	missense	possibly damaging	0.95
R9098:Adgrb1	UTSW	15	74543340	missense	probably damaging	1.00
R9157:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
R9166:Adgrb1	UTSW	15	74548626	missense	probably benign	0.00
R9313:Adgrb1	UTSW	15	74539775	missense	probably damaging	0.98
Z1177:Adgrb1	UTSW	15	74541676	missense	probably damaging	1.00
Z1177:Adgrb1	UTSW	15	74547683	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GGGACTACTGAGGATCCAAAAC -3'
(R):5'- GGCAGGTACGTATTCAATGCC -3'

Sequencing Primer
(F):5'- GGACTACTGAGGATCCAAAACAAAAC -3'
(R):5'- GGTACGTATTCAATGCCCAATATCC -3'

Posted On

2019-05-13