Incidental Mutation 'R7015:Adgrb1'
ID545274
Institutional Source Beutler Lab
Gene Symbol Adgrb1
Ensembl Gene ENSMUSG00000034730
Gene Nameadhesion G protein-coupled receptor B1
SynonymsBai1, B830018M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7015 (G1)
Quality Score216.009
Status Validated
Chromosome15
Chromosomal Location74516195-74589465 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74574110 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 1085 (L1085P)
Ref Sequence ENSEMBL: ENSMUSP00000140362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042035] [ENSMUST00000170845] [ENSMUST00000185682] [ENSMUST00000186360] [ENSMUST00000187485] [ENSMUST00000187599] [ENSMUST00000189353] [ENSMUST00000190524]
Predicted Effect probably damaging
Transcript: ENSMUST00000042035
AA Change: L1085P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000046097
Gene: ENSMUSG00000034730
AA Change: L1085P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 4.69e-10 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 3.5e-9 SMART
TSP1 412 462 3.16e-16 SMART
TSP1 470 520 7.15e-15 SMART
TSP1 525 575 3.11e-15 SMART
HormR 577 643 2.55e-20 SMART
Pfam:GAIN 656 859 1e-46 PFAM
GPS 880 938 1.46e-18 SMART
Pfam:7tm_2 944 1180 3.3e-66 PFAM
SCOP:d1jvr__ 1396 1432 5e-4 SMART
low complexity region 1441 1455 N/A INTRINSIC
low complexity region 1545 1556 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170845
AA Change: L145P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127122
Gene: ENSMUSG00000034730
AA Change: L145P

DomainStartEndE-ValueType
Pfam:7tm_2 4 240 1.9e-67 PFAM
SCOP:d1jvr__ 456 492 1e-3 SMART
low complexity region 501 515 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000185682
AA Change: L145P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139428
Gene: ENSMUSG00000034730
AA Change: L145P

DomainStartEndE-ValueType
Pfam:7tm_2 4 240 1.9e-67 PFAM
SCOP:d1jvr__ 456 492 1e-3 SMART
low complexity region 501 515 N/A INTRINSIC
low complexity region 605 616 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186360
AA Change: L1085P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140362
Gene: ENSMUSG00000034730
AA Change: L1085P

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
TSP1 357 407 1.7e-11 SMART
TSP1 412 462 1.5e-18 SMART
TSP1 470 520 3.4e-17 SMART
TSP1 525 575 1.5e-17 SMART
HormR 577 643 1.6e-22 SMART
Pfam:DUF3497 653 874 1.2e-44 PFAM
GPS 880 938 8.9e-21 SMART
Pfam:7tm_2 944 1106 9.6e-43 PFAM
low complexity region 1113 1143 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187485
SMART Domains Protein: ENSMUSP00000140959
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 141 160 N/A INTRINSIC
TSP1 264 315 2.2e-12 SMART
low complexity region 319 329 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187599
SMART Domains Protein: ENSMUSP00000140831
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
Pfam:7tm_2 4 135 6.4e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000189353
AA Change: L145P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140889
Gene: ENSMUSG00000034730
AA Change: L145P

DomainStartEndE-ValueType
Pfam:7tm_2 4 147 3.5e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190524
SMART Domains Protein: ENSMUSP00000140407
Gene: ENSMUSG00000034730

DomainStartEndE-ValueType
Pfam:7tm_2 4 112 4.3e-27 PFAM
Meta Mutation Damage Score 0.7839 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 93% (55/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiogenesis is controlled by a local balance between stimulators and inhibitors of new vessel growth and is suppressed under normal physiologic conditions. Angiogenesis has been shown to be essential for growth and metastasis of solid tumors. In order to obtain blood supply for their growth, tumor cells are potently angiogenic and attract new vessels as results of increased secretion of inducers and decreased production of endogenous negative regulators. BAI1 contains at least one 'functional' p53-binding site within an intron, and its expression has been shown to be induced by wildtype p53. There are two other brain-specific angiogenesis inhibitor genes, designated BAI2 and BAI3 which along with BAI1 have similar tissue specificities and structures, however only BAI1 is transcriptionally regulated by p53. BAI1 is postulated to be a member of the secretin receptor family, an inhibitor of angiogenesis and a growth suppressor of glioblastomas [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A G 1: 160,075,168 R3G possibly damaging Het
Abcc2 A G 19: 43,798,178 I150V probably benign Het
Agbl4 A G 4: 110,478,500 N24D probably damaging Het
Aox2 A G 1: 58,282,758 T70A probably benign Het
Aplf G A 6: 87,641,902 A399V probably damaging Het
Asxl3 A G 18: 22,523,921 S1663G probably benign Het
Bcat1 G C 6: 145,039,583 P43R probably damaging Het
Camk1 T C 6: 113,341,926 R9G probably benign Het
Casp8ap2 T C 4: 32,644,278 V1117A probably damaging Het
Cd300ld4 A T 11: 115,022,707 V174E probably benign Het
Cep85l T C 10: 53,349,055 D146G possibly damaging Het
Clip1 T C 5: 123,613,612 probably benign Het
Cog3 C T 14: 75,713,276 V719I possibly damaging Het
Col4a4 G A 1: 82,506,950 P532L unknown Het
Col6a4 C T 9: 106,033,755 probably null Het
Dync1h1 C T 12: 110,666,087 Q4547* probably null Het
Ergic1 G A 17: 26,654,879 probably benign Het
Foxn4 G A 5: 114,256,855 T337M possibly damaging Het
Gemin5 A T 11: 58,156,740 I336N probably damaging Het
Gm21905 A T 5: 67,946,362 probably null Het
Grik2 C A 10: 49,535,436 R202L probably damaging Het
Iglon5 T C 7: 43,476,927 D184G probably benign Het
Il11ra1 A T 4: 41,765,421 Q172L probably benign Het
Me2 G T 18: 73,781,147 probably null Het
Med24 A G 11: 98,718,852 V73A possibly damaging Het
Mmp24 A G 2: 155,792,624 Q88R probably damaging Het
Mroh3 A T 1: 136,183,331 V819E probably damaging Het
Mrps9 A G 1: 42,898,546 K247R probably benign Het
Myo15b G A 11: 115,871,844 R1254H Het
Ncoa5 A G 2: 165,002,081 L134P probably benign Het
Olfr628 T C 7: 103,732,817 V297A probably null Het
Olfr78 C A 7: 102,742,444 L186F probably damaging Het
Olfr984 A T 9: 40,101,455 F12I probably benign Het
Pdcd11 A G 19: 47,098,226 I224V probably benign Het
Ptprh C A 7: 4,552,627 probably null Het
Rab34 G T 11: 78,190,152 V63F probably damaging Het
Rack1 T C 11: 48,801,765 I71T probably benign Het
Rai14 G A 15: 10,589,315 R266* probably null Het
Rsph9 A G 17: 46,129,456 V238A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sel1l3 A T 5: 53,172,574 C480S probably benign Het
Sh3pxd2a C T 19: 47,268,123 A747T probably benign Het
Slc1a3 T C 15: 8,649,568 N181S probably damaging Het
Slit1 T A 19: 41,629,886 K784* probably null Het
Sos2 T A 12: 69,585,235 Q1297L probably benign Het
Srd5a2 T A 17: 74,027,119 T102S probably benign Het
Ss18l2 A T 9: 121,712,608 I64F probably damaging Het
Tas2r120 T C 6: 132,657,165 F70S possibly damaging Het
Tjap1 G A 17: 46,263,774 A5V possibly damaging Het
Tln2 A T 9: 67,362,647 M488K possibly damaging Het
Tnks T G 8: 34,838,547 I42L probably benign Het
Togaram2 A T 17: 71,709,568 Q640L possibly damaging Het
Triobp C A 15: 78,994,060 Q1682K probably damaging Het
Trip11 C T 12: 101,893,683 E311K probably damaging Het
Ugt2b5 A G 5: 87,139,796 Y171H probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Zfp990 G T 4: 145,536,635 D68Y probably damaging Het
Zranb2 A T 3: 157,536,733 probably null Het
Other mutations in Adgrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Adgrb1 APN 15 74586835 missense probably damaging 1.00
IGL01748:Adgrb1 APN 15 74548357 splice site probably benign
IGL01874:Adgrb1 APN 15 74541574 missense possibly damaging 0.95
IGL02040:Adgrb1 APN 15 74541575 missense possibly damaging 0.91
IGL02138:Adgrb1 APN 15 74529782 missense probably damaging 1.00
IGL02149:Adgrb1 APN 15 74540477 missense probably damaging 1.00
IGL02320:Adgrb1 APN 15 74574112 missense probably damaging 1.00
IGL02556:Adgrb1 APN 15 74586805 missense probably damaging 0.99
IGL02637:Adgrb1 APN 15 74588294 splice site probably benign
IGL02678:Adgrb1 APN 15 74538328 missense probably damaging 0.99
IGL02792:Adgrb1 APN 15 74547622 missense probably damaging 0.98
Bunting UTSW 15 74543701 missense probably null 0.94
PIT4520001:Adgrb1 UTSW 15 74541659 missense probably damaging 0.99
R0193:Adgrb1 UTSW 15 74572156 missense probably damaging 1.00
R0208:Adgrb1 UTSW 15 74586807 missense probably benign
R0267:Adgrb1 UTSW 15 74529389 missense probably damaging 1.00
R0336:Adgrb1 UTSW 15 74587149 missense probably benign 0.06
R0345:Adgrb1 UTSW 15 74543349 missense probably damaging 0.97
R0533:Adgrb1 UTSW 15 74541559 missense probably damaging 1.00
R0635:Adgrb1 UTSW 15 74540892 missense possibly damaging 0.88
R0729:Adgrb1 UTSW 15 74548549 missense probably damaging 1.00
R0792:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1122:Adgrb1 UTSW 15 74547685 missense probably damaging 0.99
R1295:Adgrb1 UTSW 15 74550039 missense probably damaging 1.00
R1522:Adgrb1 UTSW 15 74580617 missense probably damaging 1.00
R1696:Adgrb1 UTSW 15 74588107 missense probably damaging 1.00
R1707:Adgrb1 UTSW 15 74529343 missense probably damaging 0.99
R1750:Adgrb1 UTSW 15 74541827 missense probably benign 0.23
R1804:Adgrb1 UTSW 15 74529540 missense probably damaging 1.00
R1829:Adgrb1 UTSW 15 74580586 nonsense probably null
R1895:Adgrb1 UTSW 15 74540465 missense probably damaging 1.00
R1970:Adgrb1 UTSW 15 74539877 splice site probably benign
R2114:Adgrb1 UTSW 15 74540562 critical splice donor site probably null
R2133:Adgrb1 UTSW 15 74529908 missense probably damaging 1.00
R2210:Adgrb1 UTSW 15 74547704 missense probably damaging 1.00
R3701:Adgrb1 UTSW 15 74545015 missense probably damaging 0.99
R3770:Adgrb1 UTSW 15 74588308 missense probably damaging 1.00
R3980:Adgrb1 UTSW 15 74582943 missense probably damaging 1.00
R4355:Adgrb1 UTSW 15 74543662 missense probably damaging 1.00
R4412:Adgrb1 UTSW 15 74577453 unclassified probably benign
R4634:Adgrb1 UTSW 15 74584429 utr 3 prime probably benign
R4683:Adgrb1 UTSW 15 74588114 missense probably damaging 1.00
R4742:Adgrb1 UTSW 15 74529479 nonsense probably null
R4760:Adgrb1 UTSW 15 74571463 missense probably damaging 1.00
R4794:Adgrb1 UTSW 15 74588129 missense probably damaging 1.00
R4880:Adgrb1 UTSW 15 74587022 missense possibly damaging 0.85
R4885:Adgrb1 UTSW 15 74572162 missense probably benign 0.04
R5092:Adgrb1 UTSW 15 74529815 missense probably benign 0.39
R5198:Adgrb1 UTSW 15 74543701 missense probably null 0.94
R5225:Adgrb1 UTSW 15 74577499 unclassified probably benign
R5421:Adgrb1 UTSW 15 74550027 missense probably damaging 1.00
R5764:Adgrb1 UTSW 15 74541574 missense possibly damaging 0.95
R5914:Adgrb1 UTSW 15 74538370 missense possibly damaging 0.54
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6035:Adgrb1 UTSW 15 74540443 missense possibly damaging 0.50
R6066:Adgrb1 UTSW 15 74540459 missense probably damaging 0.99
R6423:Adgrb1 UTSW 15 74588143 critical splice donor site probably null
R6811:Adgrb1 UTSW 15 74529361 missense probably damaging 1.00
R6945:Adgrb1 UTSW 15 74550024 missense probably damaging 0.99
R7012:Adgrb1 UTSW 15 74529901 missense probably damaging 0.97
R7061:Adgrb1 UTSW 15 74569881 missense probably benign 0.00
R7209:Adgrb1 UTSW 15 74569948 missense possibly damaging 0.85
R7213:Adgrb1 UTSW 15 74569884 missense probably benign
R7283:Adgrb1 UTSW 15 74580663 missense possibly damaging 0.94
R7329:Adgrb1 UTSW 15 74539245 missense probably damaging 0.99
R7616:Adgrb1 UTSW 15 74548569 missense probably damaging 0.98
R7695:Adgrb1 UTSW 15 74543638 missense possibly damaging 0.95
Z1177:Adgrb1 UTSW 15 74541676 missense probably damaging 1.00
Z1177:Adgrb1 UTSW 15 74547683 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGACTACTGAGGATCCAAAAC -3'
(R):5'- GGCAGGTACGTATTCAATGCC -3'

Sequencing Primer
(F):5'- GGACTACTGAGGATCCAAAACAAAAC -3'
(R):5'- GGTACGTATTCAATGCCCAATATCC -3'
Posted On2019-05-13