Mutagenetix > Incidental Mutations

Incidental Mutation 'R7015:Triobp'

545275

Institutional Source

Beutler Lab

Gene Symbol

Triobp

Ensembl Gene

ENSMUSG00000033088

Gene Name

TRIO and F-actin binding protein

Synonyms

EST478828, Mus EST 478828, Tara

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7015 (G1)

Quality Score

199.009

Status

Validated

Chromosome

Chromosomal Location

78947724-79005869 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 78994060 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 1682 (Q1682K)

Ref Sequence

ENSEMBL: ENSMUSP00000105311 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000109687] [ENSMUST00000109689] [ENSMUST00000109690] [ENSMUST00000130663] [ENSMUST00000144151] [ENSMUST00000229270]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109687
AA Change: Q341K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000105309
Gene: ENSMUSG00000033088
AA Change: Q341K

Domain	Start	End	E-Value	Type
PH	7	104	6.2e-19	SMART
coiled coil region	277	304	N/A	INTRINSIC
coiled coil region	339	377	N/A	INTRINSIC
coiled coil region	401	463	N/A	INTRINSIC
coiled coil region	497	576	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109689
AA Change: Q1682K

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000105311
Gene: ENSMUSG00000033088
AA Change: Q1682K

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	7.43e-13	PROSPERO
internal_repeat_1	390	540	7.43e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1395	1492	6.2e-19	SMART
coiled coil region	1665	1692	N/A	INTRINSIC
coiled coil region	1727	1765	N/A	INTRINSIC
coiled coil region	1789	1851	N/A	INTRINSIC
coiled coil region	1885	1964	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109690
AA Change: Q1728K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000105312
Gene: ENSMUSG00000033088
AA Change: Q1728K

Domain	Start	End	E-Value	Type
low complexity region	130	154	N/A	INTRINSIC
low complexity region	291	311	N/A	INTRINSIC
internal_repeat_1	312	394	9.24e-13	PROSPERO
internal_repeat_1	390	540	9.24e-13	PROSPERO
low complexity region	585	600	N/A	INTRINSIC
low complexity region	638	657	N/A	INTRINSIC
low complexity region	697	729	N/A	INTRINSIC
low complexity region	767	777	N/A	INTRINSIC
low complexity region	885	901	N/A	INTRINSIC
low complexity region	903	923	N/A	INTRINSIC
low complexity region	995	1017	N/A	INTRINSIC
low complexity region	1054	1068	N/A	INTRINSIC
low complexity region	1221	1235	N/A	INTRINSIC
PH	1441	1538	6.2e-19	SMART
coiled coil region	1711	1738	N/A	INTRINSIC
coiled coil region	1773	1811	N/A	INTRINSIC
coiled coil region	1835	1897	N/A	INTRINSIC
coiled coil region	1931	2010	N/A	INTRINSIC

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122988
Gene: ENSMUSG00000033088
AA Change: Q336K

Domain	Start	End	E-Value	Type
PH	7	104	6.2e-19	SMART
coiled coil region	277	304	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000144151

SMART Domains

Protein: ENSMUSP00000116765
Gene: ENSMUSG00000033088

Domain	Start	End	E-Value	Type
PH	1	92	1.04e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000229270

Meta Mutation Damage Score

0.27

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

93% (55/59)

MGI Phenotype

FUNCTION: This gene encodes a protein that interacts with trio, which is involved with neural tissue development and controlling actin cytoskeleton organization, cell motility, and cell growth. The encoded protein also associates with F-actin and stabilizes F-actin structures. Domains contained in this encoded protein are an N-terminal pleckstrin homology domain and a C-terminal coiled-coil region. Mutations in the human gene have been associated with a form of autosomal recessive nonsyndromic deafness. Multiple alternatively spliced transcript variants have been described [provided by RefSeq, Sep 2012]
PHENOTYPE: Mice homozygous for gene trapped alleles exhibit embryonic lethality. Mice homozygous for a targeted allele eliminating isoforms 4 and 5 exhibit profound deafness associated with stereocilia fragility and degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930523C07Rik	A	G	1: 160,075,168	R3G	possibly damaging	Het
Abcc2	A	G	19: 43,798,178	I150V	probably benign	Het
Adgrb1	T	C	15: 74,574,110	L1085P	probably damaging	Het
Agbl4	A	G	4: 110,478,500	N24D	probably damaging	Het
Aox2	A	G	1: 58,282,758	T70A	probably benign	Het
Aplf	G	A	6: 87,641,902	A399V	probably damaging	Het
Asxl3	A	G	18: 22,523,921	S1663G	probably benign	Het
Bcat1	G	C	6: 145,039,583	P43R	probably damaging	Het
Camk1	T	C	6: 113,341,926	R9G	probably benign	Het
Casp8ap2	T	C	4: 32,644,278	V1117A	probably damaging	Het
Cd300ld4	A	T	11: 115,022,707	V174E	probably benign	Het
Cep85l	T	C	10: 53,349,055	D146G	possibly damaging	Het
Clip1	T	C	5: 123,613,612		probably benign	Het
Cog3	C	T	14: 75,713,276	V719I	possibly damaging	Het
Col4a4	G	A	1: 82,506,950	P532L	unknown	Het
Col6a4	C	T	9: 106,033,755		probably null	Het
Dync1h1	C	T	12: 110,666,087	Q4547*	probably null	Het
Ergic1	G	A	17: 26,654,879		probably benign	Het
Foxn4	G	A	5: 114,256,855	T337M	possibly damaging	Het
Gemin5	A	T	11: 58,156,740	I336N	probably damaging	Het
Gm21905	A	T	5: 67,946,362		probably null	Het
Grik2	C	A	10: 49,535,436	R202L	probably damaging	Het
Iglon5	T	C	7: 43,476,927	D184G	probably benign	Het
Il11ra1	A	T	4: 41,765,421	Q172L	probably benign	Het
Me2	G	T	18: 73,781,147		probably null	Het
Med24	A	G	11: 98,718,852	V73A	possibly damaging	Het
Mmp24	A	G	2: 155,792,624	Q88R	probably damaging	Het
Mroh3	A	T	1: 136,183,331	V819E	probably damaging	Het
Mrps9	A	G	1: 42,898,546	K247R	probably benign	Het
Myo15b	G	A	11: 115,871,844	R1254H		Het
Ncoa5	A	G	2: 165,002,081	L134P	probably benign	Het
Olfr628	T	C	7: 103,732,817	V297A	probably null	Het
Olfr78	C	A	7: 102,742,444	L186F	probably damaging	Het
Olfr984	A	T	9: 40,101,455	F12I	probably benign	Het
Pdcd11	A	G	19: 47,098,226	I224V	probably benign	Het
Ptprh	C	A	7: 4,552,627		probably null	Het
Rab34	G	T	11: 78,190,152	V63F	probably damaging	Het
Rack1	T	C	11: 48,801,765	I71T	probably benign	Het
Rai14	G	A	15: 10,589,315	R266*	probably null	Het
Rsph9	A	G	17: 46,129,456	V238A	probably benign	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Sel1l3	A	T	5: 53,172,574	C480S	probably benign	Het
Sh3pxd2a	C	T	19: 47,268,123	A747T	probably benign	Het
Slc1a3	T	C	15: 8,649,568	N181S	probably damaging	Het
Slit1	T	A	19: 41,629,886	K784*	probably null	Het
Sos2	T	A	12: 69,585,235	Q1297L	probably benign	Het
Srd5a2	T	A	17: 74,027,119	T102S	probably benign	Het
Ss18l2	A	T	9: 121,712,608	I64F	probably damaging	Het
Tas2r120	T	C	6: 132,657,165	F70S	possibly damaging	Het
Tjap1	G	A	17: 46,263,774	A5V	possibly damaging	Het
Tln2	A	T	9: 67,362,647	M488K	possibly damaging	Het
Tnks	T	G	8: 34,838,547	I42L	probably benign	Het
Togaram2	A	T	17: 71,709,568	Q640L	possibly damaging	Het
Trip11	C	T	12: 101,893,683	E311K	probably damaging	Het
Ugt2b5	A	G	5: 87,139,796	Y171H	probably damaging	Het
Vmn2r66	T	C	7: 84,995,558	D548G	possibly damaging	Het
Zfp990	G	T	4: 145,536,635	D68Y	probably damaging	Het
Zranb2	A	T	3: 157,536,733		probably null	Het

Other mutations in Triobp

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01634:Triobp	APN	15	78993368	missense	probably damaging	1.00
IGL01904:Triobp	APN	15	78967364	missense	possibly damaging	0.80
IGL01957:Triobp	APN	15	78972647	critical splice donor site	probably null
IGL02085:Triobp	APN	15	78974297	splice site	probably benign
IGL02260:Triobp	APN	15	78966362	missense	probably benign	0.00
IGL02498:Triobp	APN	15	78961043	missense	probably benign	0.01
IGL02551:Triobp	APN	15	78973489	missense	probably benign
IGL02740:Triobp	APN	15	78966689	missense	probably benign	0.21
IGL02810:Triobp	APN	15	79002203	missense	possibly damaging	0.95
IGL03063:Triobp	APN	15	78990884	missense	probably damaging	1.00
FR4304:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4340:Triobp	UTSW	15	78993390	unclassified	probably benign
FR4342:Triobp	UTSW	15	78993392	unclassified	probably benign
FR4449:Triobp	UTSW	15	78993389	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993387	unclassified	probably benign
FR4548:Triobp	UTSW	15	78993390	unclassified	probably benign
R0276:Triobp	UTSW	15	78973676	missense	probably benign	0.09
R0309:Triobp	UTSW	15	78976540	missense	probably damaging	1.00
R0433:Triobp	UTSW	15	78968201	missense	possibly damaging	0.69
R0464:Triobp	UTSW	15	78966986	missense	possibly damaging	0.71
R0525:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0665:Triobp	UTSW	15	78973898	missense	possibly damaging	0.93
R0689:Triobp	UTSW	15	78959988	nonsense	probably null
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1149:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1151:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1152:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1510:Triobp	UTSW	15	79003767	missense	probably damaging	1.00
R1519:Triobp	UTSW	15	78973738	missense	probably benign	0.00
R1642:Triobp	UTSW	15	79002148	missense	probably damaging	1.00
R1732:Triobp	UTSW	15	78967228	missense	possibly damaging	0.69
R1755:Triobp	UTSW	15	78966479	missense	probably benign	0.00
R1975:Triobp	UTSW	15	78966708	missense	probably benign
R2051:Triobp	UTSW	15	79004540	missense	probably damaging	1.00
R2073:Triobp	UTSW	15	78973895	missense	probably damaging	0.99
R2260:Triobp	UTSW	15	78991440	critical splice donor site	probably null
R2351:Triobp	UTSW	15	79004580	missense	probably benign	0.09
R2902:Triobp	UTSW	15	78973418	missense	possibly damaging	0.90
R3801:Triobp	UTSW	15	78973700	missense	probably benign	0.04
R3959:Triobp	UTSW	15	79002389	nonsense	probably null
R4003:Triobp	UTSW	15	78959977	unclassified	probably benign
R4084:Triobp	UTSW	15	78973671	missense	probably benign	0.19
R4482:Triobp	UTSW	15	78966563	missense	possibly damaging	0.87
R4592:Triobp	UTSW	15	78967095	missense	probably benign
R4662:Triobp	UTSW	15	78993269	missense	probably damaging	1.00
R4732:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4733:Triobp	UTSW	15	78967113	missense	probably damaging	0.99
R4789:Triobp	UTSW	15	78991028	missense	probably damaging	1.00
R4968:Triobp	UTSW	15	78966616	missense	probably benign	0.03
R4990:Triobp	UTSW	15	78967005	missense	probably benign	0.00
R5129:Triobp	UTSW	15	78961096	missense	probably benign	0.15
R5181:Triobp	UTSW	15	78967754	missense	probably benign	0.00
R5279:Triobp	UTSW	15	78994391	missense	possibly damaging	0.66
R5584:Triobp	UTSW	15	78968132	missense	possibly damaging	0.89
R5601:Triobp	UTSW	15	78973633	missense	probably damaging	1.00
R5810:Triobp	UTSW	15	78968267	missense	probably benign	0.07
R5969:Triobp	UTSW	15	78967540	missense	probably benign	0.05
R6722:Triobp	UTSW	15	79001565	missense	probably damaging	1.00
R6739:Triobp	UTSW	15	78966366	missense	possibly damaging	0.77
R6810:Triobp	UTSW	15	78966615	missense	possibly damaging	0.47
R7011:Triobp	UTSW	15	78978723	missense	probably damaging	0.98
R7200:Triobp	UTSW	15	78966842	small deletion	probably benign
R7294:Triobp	UTSW	15	78973976	missense	probably damaging	0.99
X0026:Triobp	UTSW	15	78960023	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- AGCTCACCCAGGTCATTGAC -3'
(R):5'- CCAAACATGGGTGCTCTTTGAC -3'

Sequencing Primer
(F):5'- GAGACACAAAGTTCCTTGTCGGTC -3'
(R):5'- GGTGCTCTTTGACAACACAG -3'

Posted On

2019-05-13