Incidental Mutation 'R7015:Togaram2'
ID545279
Institutional Source Beutler Lab
Gene Symbol Togaram2
Ensembl Gene ENSMUSG00000045761
Gene NameTOG array regulator of axonemal microtubules 2
SynonymsFam179a, 4632412N22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R7015 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location71673261-71729669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71709568 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 640 (Q640L)
Ref Sequence ENSEMBL: ENSMUSP00000114359 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097284] [ENSMUST00000144479] [ENSMUST00000153445]
Predicted Effect probably benign
Transcript: ENSMUST00000097284
AA Change: Q639L

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000094886
Gene: ENSMUSG00000045761
AA Change: Q639L

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000144479
AA Change: Q640L

PolyPhen 2 Score 0.616 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000114359
Gene: ENSMUSG00000045761
AA Change: Q640L

DomainStartEndE-ValueType
low complexity region 50 61 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Pfam:CLASP_N 493 706 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153445
AA Change: Q639L

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122691
Gene: ENSMUSG00000045761
AA Change: Q639L

DomainStartEndE-ValueType
low complexity region 49 60 N/A INTRINSIC
low complexity region 94 105 N/A INTRINSIC
low complexity region 467 474 N/A INTRINSIC
Pfam:CLASP_N 492 705 2.3e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 93% (55/59)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930523C07Rik A G 1: 160,075,168 R3G possibly damaging Het
Abcc2 A G 19: 43,798,178 I150V probably benign Het
Adgrb1 T C 15: 74,574,110 L1085P probably damaging Het
Agbl4 A G 4: 110,478,500 N24D probably damaging Het
Aox2 A G 1: 58,282,758 T70A probably benign Het
Aplf G A 6: 87,641,902 A399V probably damaging Het
Asxl3 A G 18: 22,523,921 S1663G probably benign Het
Bcat1 G C 6: 145,039,583 P43R probably damaging Het
Camk1 T C 6: 113,341,926 R9G probably benign Het
Casp8ap2 T C 4: 32,644,278 V1117A probably damaging Het
Cd300ld4 A T 11: 115,022,707 V174E probably benign Het
Cep85l T C 10: 53,349,055 D146G possibly damaging Het
Clip1 T C 5: 123,613,612 probably benign Het
Cog3 C T 14: 75,713,276 V719I possibly damaging Het
Col4a4 G A 1: 82,506,950 P532L unknown Het
Col6a4 C T 9: 106,033,755 probably null Het
Dync1h1 C T 12: 110,666,087 Q4547* probably null Het
Ergic1 G A 17: 26,654,879 probably benign Het
Foxn4 G A 5: 114,256,855 T337M possibly damaging Het
Gemin5 A T 11: 58,156,740 I336N probably damaging Het
Gm21905 A T 5: 67,946,362 probably null Het
Grik2 C A 10: 49,535,436 R202L probably damaging Het
Iglon5 T C 7: 43,476,927 D184G probably benign Het
Il11ra1 A T 4: 41,765,421 Q172L probably benign Het
Me2 G T 18: 73,781,147 probably null Het
Med24 A G 11: 98,718,852 V73A possibly damaging Het
Mmp24 A G 2: 155,792,624 Q88R probably damaging Het
Mroh3 A T 1: 136,183,331 V819E probably damaging Het
Mrps9 A G 1: 42,898,546 K247R probably benign Het
Myo15b G A 11: 115,871,844 R1254H Het
Ncoa5 A G 2: 165,002,081 L134P probably benign Het
Olfr628 T C 7: 103,732,817 V297A probably null Het
Olfr78 C A 7: 102,742,444 L186F probably damaging Het
Olfr984 A T 9: 40,101,455 F12I probably benign Het
Pdcd11 A G 19: 47,098,226 I224V probably benign Het
Ptprh C A 7: 4,552,627 probably null Het
Rab34 G T 11: 78,190,152 V63F probably damaging Het
Rack1 T C 11: 48,801,765 I71T probably benign Het
Rai14 G A 15: 10,589,315 R266* probably null Het
Rsph9 A G 17: 46,129,456 V238A probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Sel1l3 A T 5: 53,172,574 C480S probably benign Het
Sh3pxd2a C T 19: 47,268,123 A747T probably benign Het
Slc1a3 T C 15: 8,649,568 N181S probably damaging Het
Slit1 T A 19: 41,629,886 K784* probably null Het
Sos2 T A 12: 69,585,235 Q1297L probably benign Het
Srd5a2 T A 17: 74,027,119 T102S probably benign Het
Ss18l2 A T 9: 121,712,608 I64F probably damaging Het
Tas2r120 T C 6: 132,657,165 F70S possibly damaging Het
Tjap1 G A 17: 46,263,774 A5V possibly damaging Het
Tln2 A T 9: 67,362,647 M488K possibly damaging Het
Tnks T G 8: 34,838,547 I42L probably benign Het
Triobp C A 15: 78,994,060 Q1682K probably damaging Het
Trip11 C T 12: 101,893,683 E311K probably damaging Het
Ugt2b5 A G 5: 87,139,796 Y171H probably damaging Het
Vmn2r66 T C 7: 84,995,558 D548G possibly damaging Het
Zfp990 G T 4: 145,536,635 D68Y probably damaging Het
Zranb2 A T 3: 157,536,733 probably null Het
Other mutations in Togaram2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Togaram2 APN 17 71725004 missense probably damaging 1.00
IGL01298:Togaram2 APN 17 71716513 missense possibly damaging 0.71
IGL01625:Togaram2 APN 17 71714698 missense probably benign 0.06
IGL01691:Togaram2 APN 17 71729490 missense probably null 0.02
IGL02165:Togaram2 APN 17 71697866 missense probably benign 0.00
IGL02186:Togaram2 APN 17 71685171 missense possibly damaging 0.64
IGL02664:Togaram2 APN 17 71729239 missense probably damaging 0.97
IGL02712:Togaram2 APN 17 71704754 missense probably benign 0.04
IGL03000:Togaram2 APN 17 71717370 missense probably benign 0.08
IGL03209:Togaram2 APN 17 71695745 critical splice donor site probably null
R0211:Togaram2 UTSW 17 71729248 missense probably damaging 1.00
R0212:Togaram2 UTSW 17 71724983 missense probably damaging 1.00
R0219:Togaram2 UTSW 17 71714230 splice site probably benign
R0268:Togaram2 UTSW 17 71697998 critical splice donor site probably null
R0617:Togaram2 UTSW 17 71700509 missense possibly damaging 0.87
R0831:Togaram2 UTSW 17 71716444 missense probably damaging 1.00
R0972:Togaram2 UTSW 17 71707314 missense probably damaging 1.00
R1635:Togaram2 UTSW 17 71697851 missense probably benign 0.05
R1799:Togaram2 UTSW 17 71691455 missense probably damaging 1.00
R2062:Togaram2 UTSW 17 71716365 missense probably benign 0.26
R2414:Togaram2 UTSW 17 71716309 intron probably benign
R2866:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R2867:Togaram2 UTSW 17 71709597 missense probably benign 0.00
R4066:Togaram2 UTSW 17 71716238 intron probably benign
R4807:Togaram2 UTSW 17 71697923 missense probably damaging 1.00
R5659:Togaram2 UTSW 17 71687672 missense probably damaging 0.96
R5680:Togaram2 UTSW 17 71689209 missense probably benign 0.00
R5975:Togaram2 UTSW 17 71729205 missense probably damaging 1.00
R5996:Togaram2 UTSW 17 71704783 missense probably damaging 0.99
R6619:Togaram2 UTSW 17 71689271 missense probably damaging 0.99
R6682:Togaram2 UTSW 17 71704754 missense probably benign 0.04
R6922:Togaram2 UTSW 17 71707134 missense probably damaging 1.00
R6956:Togaram2 UTSW 17 71729188 missense probably benign 0.00
R6968:Togaram2 UTSW 17 71709613 missense probably damaging 1.00
R7007:Togaram2 UTSW 17 71709643 missense probably damaging 0.99
R7140:Togaram2 UTSW 17 71714766 missense probably benign 0.00
R7383:Togaram2 UTSW 17 71700517 missense probably damaging 1.00
R7691:Togaram2 UTSW 17 71716410 missense probably benign 0.16
R7778:Togaram2 UTSW 17 71704751 missense probably benign 0.00
R7824:Togaram2 UTSW 17 71704751 missense probably benign 0.00
R7862:Togaram2 UTSW 17 71689173 missense probably benign 0.00
R7864:Togaram2 UTSW 17 71700940 missense probably damaging 0.96
R7968:Togaram2 UTSW 17 71717433 missense probably benign 0.18
R8125:Togaram2 UTSW 17 71716494 missense probably benign 0.16
R8331:Togaram2 UTSW 17 71729226 missense probably damaging 1.00
R8354:Togaram2 UTSW 17 71697878 missense probably benign 0.00
R8454:Togaram2 UTSW 17 71697878 missense probably benign 0.00
X0063:Togaram2 UTSW 17 71707197 missense possibly damaging 0.91
Z1088:Togaram2 UTSW 17 71714280 missense possibly damaging 0.87
Z1177:Togaram2 UTSW 17 71701002 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AATGCTGTGGTCAACTTTGGC -3'
(R):5'- AACTCTGAGGATGCTGAGCTG -3'

Sequencing Primer
(F):5'- TGCCCCCAGTCATATGAGG -3'
(R):5'- ATGCTGAGCTGTGAGGCCAG -3'
Posted On2019-05-13