Incidental Mutation 'R7016:Hjurp'
ID 545287
Institutional Source Beutler Lab
Gene Symbol Hjurp
Ensembl Gene ENSMUSG00000044783
Gene Name Holliday junction recognition protein
Synonyms A730008H23Rik, C330011F01Rik, 6430706D22Rik
MMRRC Submission 045117-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.915) question?
Stock # R7016 (G1)
Quality Score 217.468
Status Validated
Chromosome 1
Chromosomal Location 88190193-88205355 bp(-) (GRCm39)
Type of Mutation utr 3 prime
DNA Base Change (assembly) TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT at 88194000 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120753 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054674] [ENSMUST00000061013] [ENSMUST00000065420] [ENSMUST00000113130] [ENSMUST00000127446] [ENSMUST00000147393]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000054674
SMART Domains Protein: ENSMUSP00000054263
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 11 68 1.5e-10 PFAM
low complexity region 159 175 N/A INTRINSIC
low complexity region 215 232 N/A INTRINSIC
Pfam:HJURP_mid 254 370 7.6e-54 PFAM
Pfam:HJURP_C 385 446 3.1e-26 PFAM
low complexity region 496 515 N/A INTRINSIC
Pfam:HJURP_C 527 585 7.1e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000061013
SMART Domains Protein: ENSMUSP00000130508
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1235 1248 N/A INTRINSIC
SCOP:d1jdha_ 1371 1669 9e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065420
SMART Domains Protein: ENSMUSP00000070419
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 2.9e-11 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 139 156 N/A INTRINSIC
Pfam:HJURP_mid 178 295 7.4e-64 PFAM
Pfam:HJURP_C 309 371 1.2e-26 PFAM
low complexity region 420 439 N/A INTRINSIC
Pfam:HJURP_C 451 510 3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113130
SMART Domains Protein: ENSMUSP00000108755
Gene: ENSMUSG00000079429

DomainStartEndE-ValueType
low complexity region 9 26 N/A INTRINSIC
low complexity region 99 112 N/A INTRINSIC
low complexity region 1232 1245 N/A INTRINSIC
SCOP:d1gw5a_ 1446 1671 6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127446
Predicted Effect probably benign
Transcript: ENSMUST00000147393
SMART Domains Protein: ENSMUSP00000120753
Gene: ENSMUSG00000044783

DomainStartEndE-ValueType
Pfam:Scm3 9 70 7.2e-13 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T A 5: 8,986,843 (GRCm39) V754D probably benign Het
Actn1 T A 12: 80,219,742 (GRCm39) M710L possibly damaging Het
Adam1a A G 5: 121,659,101 (GRCm39) F64S probably benign Het
Aip G T 19: 4,171,402 (GRCm39) D11E probably benign Het
Ak7 T A 12: 105,747,938 (GRCm39) Y714* probably null Het
Amhr2 A G 15: 102,362,799 (GRCm39) E522G possibly damaging Het
Amotl1 A G 9: 14,504,995 (GRCm39) L108P probably damaging Het
Arhgef17 A G 7: 100,528,184 (GRCm39) S677P probably benign Het
Asph T C 4: 9,630,604 (GRCm39) probably null Het
Atp11b T C 3: 35,895,185 (GRCm39) S908P probably benign Het
Atp13a3 C A 16: 30,157,308 (GRCm39) V903L possibly damaging Het
Bcam G A 7: 19,492,368 (GRCm39) R576* probably null Het
Btbd2 A G 10: 80,484,449 (GRCm39) S141P probably damaging Het
Cacna1b T C 2: 24,652,860 (GRCm39) N67S possibly damaging Het
Cc2d2b A G 19: 40,784,248 (GRCm39) T872A possibly damaging Het
Ccdc24 T A 4: 117,728,313 (GRCm39) I144F probably null Het
Cep44 A T 8: 56,997,234 (GRCm39) F101L possibly damaging Het
Cfap410 T A 10: 77,818,790 (GRCm39) C154S probably benign Het
Cimap1d T C 10: 79,475,790 (GRCm39) Y258C probably damaging Het
Disp1 C A 1: 182,869,030 (GRCm39) R1130L probably damaging Het
Dnajc21 G T 15: 10,461,493 (GRCm39) Y152* probably null Het
Edem2 A G 2: 155,557,992 (GRCm39) F214L possibly damaging Het
Fam118b G A 9: 35,135,014 (GRCm39) R198W probably damaging Het
Fgb A G 3: 82,953,371 (GRCm39) V133A probably benign Het
Fsip2 A G 2: 82,820,979 (GRCm39) T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Hnf4a T A 2: 163,406,193 (GRCm39) Y277N probably damaging Het
Htatip2 A G 7: 49,420,583 (GRCm39) D143G possibly damaging Het
Itgae A G 11: 73,010,342 (GRCm39) N611D probably damaging Het
Ksr1 A T 11: 78,918,362 (GRCm39) N515K probably damaging Het
Lrp1 C A 10: 127,395,836 (GRCm39) probably null Het
Map3k20 T A 2: 72,208,979 (GRCm39) V195D probably damaging Het
Meox2 A G 12: 37,159,223 (GRCm39) S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nell2 T A 15: 95,127,032 (GRCm39) N781I possibly damaging Het
Or12d16-ps1 G A 17: 37,706,094 (GRCm39) G221D possibly damaging Het
Or13a22 A G 7: 140,073,153 (GRCm39) T201A probably benign Het
Or51m1 A G 7: 103,578,737 (GRCm39) I236V probably benign Het
Or5e1 A G 7: 108,354,918 (GRCm39) N285S probably damaging Het
Otoa A T 7: 120,746,989 (GRCm39) Q918L probably damaging Het
Palld T G 8: 61,969,032 (GRCm39) K1022T probably damaging Het
Parp8 A T 13: 117,031,627 (GRCm39) S362T probably damaging Het
Phrf1 A G 7: 140,817,476 (GRCm39) E95G probably damaging Het
Pls1 A T 9: 95,668,994 (GRCm39) F76I probably damaging Het
Pnp T A 14: 51,187,706 (GRCm39) probably null Het
Ptdss1 A C 13: 67,120,685 (GRCm39) M294L probably benign Het
Rictor T A 15: 6,804,361 (GRCm39) probably null Het
Rilp A G 11: 75,401,745 (GRCm39) E175G probably damaging Het
Serpina16 T A 12: 103,641,630 (GRCm39) T32S probably benign Het
Sim1 C T 10: 50,860,346 (GRCm39) S736L probably benign Het
Smarcc2 T G 10: 128,321,198 (GRCm39) probably null Het
Smtn A G 11: 3,480,368 (GRCm39) probably null Het
Sspo T A 6: 48,426,098 (GRCm39) W98R probably damaging Het
St8sia3 A T 18: 64,402,654 (GRCm39) I98F probably benign Het
Taf10 A T 7: 105,393,205 (GRCm39) probably null Het
Tasor2 A T 13: 3,626,857 (GRCm39) V1031E possibly damaging Het
Tbc1d4 T A 14: 101,724,877 (GRCm39) N580I probably damaging Het
Trim12c A T 7: 103,997,413 (GRCm39) C48S Het
Tsc22d1 C A 14: 76,654,982 (GRCm39) T405K probably damaging Het
Tubgcp5 A G 7: 55,443,977 (GRCm39) D2G possibly damaging Het
Wwc2 T C 8: 48,300,583 (GRCm39) E960G unknown Het
Yme1l1 T A 2: 23,076,367 (GRCm39) probably null Het
Zbtb2 G C 10: 4,318,646 (GRCm39) P460R probably damaging Het
Zfp62 T G 11: 49,106,764 (GRCm39) I285S probably damaging Het
Other mutations in Hjurp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Hjurp APN 1 88,197,991 (GRCm39) missense probably benign 0.04
IGL03099:Hjurp APN 1 88,194,011 (GRCm39) missense probably benign 0.09
BB003:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
IGL03097:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03098:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
IGL03147:Hjurp UTSW 1 88,194,002 (GRCm39) utr 3 prime probably benign
PIT4131001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
PIT4142001:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
PIT4142001:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
PIT4142001:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
PIT4378001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
PIT4812001:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R0053:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0371:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R0442:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R0762:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R0928:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1333:Hjurp UTSW 1 88,193,768 (GRCm39) missense probably damaging 0.98
R1342:Hjurp UTSW 1 88,205,090 (GRCm39) splice site probably benign
R1364:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R1496:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R1637:Hjurp UTSW 1 88,193,843 (GRCm39) missense probably benign 0.03
R1905:Hjurp UTSW 1 88,194,338 (GRCm39) missense probably benign 0.04
R1965:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R1992:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2002:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2023:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2024:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2332:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R2420:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2422:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R2869:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2870:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2871:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R2872:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3019:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3021:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3150:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R3411:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3552:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3704:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3730:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3733:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3764:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3799:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3819:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R3857:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3930:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R3952:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4090:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4159:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4207:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4322:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4391:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4392:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4393:Hjurp UTSW 1 88,194,283 (GRCm39) utr 3 prime probably benign
R4397:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4700:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4808:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R4900:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R4901:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5023:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5024:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5076:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5123:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R5236:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5300:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5318:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5370:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5410:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5445:Hjurp UTSW 1 88,194,038 (GRCm39) missense probably benign 0.43
R5457:Hjurp UTSW 1 88,194,247 (GRCm39) frame shift probably null
R5497:Hjurp UTSW 1 88,194,042 (GRCm39) missense possibly damaging 0.92
R5560:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5561:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5615:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R5661:Hjurp UTSW 1 88,204,937 (GRCm39) splice site probably benign
R5722:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6087:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6089:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6090:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6125:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6175:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R6362:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R6659:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R7016:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7045:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7179:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7200:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R7463:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R7912:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R8215:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R8968:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9038:Hjurp UTSW 1 88,194,246 (GRCm39) nonsense probably null
R9115:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9133:Hjurp UTSW 1 88,202,772 (GRCm39) missense possibly damaging 0.59
R9146:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9221:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9475:Hjurp UTSW 1 88,193,999 (GRCm39) utr 3 prime probably benign
R9482:Hjurp UTSW 1 88,193,996 (GRCm39) utr 3 prime probably benign
R9565:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
R9599:Hjurp UTSW 1 88,194,000 (GRCm39) utr 3 prime probably benign
V5622:Hjurp UTSW 1 88,205,247 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTCGCTCACGGTTTAAGTCC -3'
(R):5'- CAGCGATTTGTATGAAGGCATG -3'

Sequencing Primer
(F):5'- GCTCACGGTTTAAGTCCAAGTC -3'
(R):5'- CATGATGCATTCCATGAGTAGGC -3'
Posted On 2019-05-13