Incidental Mutation 'R7016:Fgb'
ID545295
Institutional Source Beutler Lab
Gene Symbol Fgb
Ensembl Gene ENSMUSG00000033831
Gene Namefibrinogen beta chain
Synonyms2510049G14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location83040141-83049863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83046064 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 133 (V133A)
Ref Sequence ENSEMBL: ENSMUSP00000039472 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048246]
Predicted Effect probably benign
Transcript: ENSMUST00000048246
AA Change: V133A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000039472
Gene: ENSMUSG00000033831
AA Change: V133A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 46 55 N/A INTRINSIC
Fib_alpha 80 225 1.28e-64 SMART
FBG 226 477 1.6e-140 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the coagulation factor fibrinogen, which is a component of the blood clot. The encoded preproprotein is proteolytically processed by thrombin to release an N-terminal fibrinopeptide during the conversion of fibrinogen to insoluble fibrin polymer. The encoded protein interacts with the amyloid beta peptide to form fibrin clots of abnormal structure, and may play an important role in Alzheimer's disease. This gene is located adjacent to the genes encoding fibrinogen alpha and gamma subunits on chromosome 3. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Dnajc21 G T 15: 10,461,407 Y152* probably null Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Fgb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Fgb APN 3 83043291 missense possibly damaging 0.95
IGL02129:Fgb APN 3 83043418 missense probably benign 0.05
IGL02148:Fgb APN 3 83043287 missense probably damaging 0.99
IGL02286:Fgb APN 3 83043326 missense probably benign
IGL02601:Fgb APN 3 83045060 missense probably benign 0.06
IGL02721:Fgb APN 3 83043367 missense possibly damaging 0.89
R1217:Fgb UTSW 3 83043257 missense probably damaging 0.99
R1424:Fgb UTSW 3 83046763 missense probably damaging 0.99
R1913:Fgb UTSW 3 83044980 missense probably benign 0.03
R1990:Fgb UTSW 3 83044253 nonsense probably null
R2063:Fgb UTSW 3 83049689 missense probably benign 0.09
R2065:Fgb UTSW 3 83049689 missense probably benign 0.09
R2066:Fgb UTSW 3 83049689 missense probably benign 0.09
R2067:Fgb UTSW 3 83049689 missense probably benign 0.09
R2251:Fgb UTSW 3 83043284 missense probably damaging 1.00
R4682:Fgb UTSW 3 83043265 missense probably benign 0.00
R5045:Fgb UTSW 3 83043373 missense probably damaging 1.00
R5573:Fgb UTSW 3 83049677 splice site probably null
R5766:Fgb UTSW 3 83046176 missense probably damaging 1.00
R6103:Fgb UTSW 3 83043863 missense probably benign 0.22
R6315:Fgb UTSW 3 83045055 missense probably benign 0.00
R6469:Fgb UTSW 3 83046142 nonsense probably null
R6664:Fgb UTSW 3 83046759 missense probably damaging 1.00
R6725:Fgb UTSW 3 83043791 missense probably damaging 1.00
R6727:Fgb UTSW 3 83046787 missense possibly damaging 0.62
R6830:Fgb UTSW 3 83045025 missense probably benign 0.07
R7132:Fgb UTSW 3 83046746 nonsense probably null
R7371:Fgb UTSW 3 83046052 missense probably damaging 0.99
R7430:Fgb UTSW 3 83046707 missense probably benign 0.26
R7681:Fgb UTSW 3 83049832 start gained probably benign
R7811:Fgb UTSW 3 83049697 missense probably benign
Z1177:Fgb UTSW 3 83045056 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGTCTTGTCTGGCAAACTGC -3'
(R):5'- TGACTCACAGAGATCACGAAAG -3'

Sequencing Primer
(F):5'- GCAAGTGCTGGTTAACCCTG -3'
(R):5'- ACTCACAGAGATCACGAAAGTCTCTC -3'
Posted On2019-05-13