Incidental Mutation 'R7016:Parp8'
ID 545335
Institutional Source Beutler Lab
Gene Symbol Parp8
Ensembl Gene ENSMUSG00000021725
Gene Name poly (ADP-ribose) polymerase family, member 8
Synonyms D13Ertd275e, 2810430O08Rik
MMRRC Submission 045117-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7016 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 116991356-117162073 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 117031627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 362 (S362T)
Ref Sequence ENSEMBL: ENSMUSP00000022239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022239] [ENSMUST00000223949] [ENSMUST00000225344] [ENSMUST00000226107]
AlphaFold Q3UD82
Predicted Effect probably damaging
Transcript: ENSMUST00000022239
AA Change: S362T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000022239
Gene: ENSMUSG00000021725
AA Change: S362T

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 22 34 N/A INTRINSIC
low complexity region 163 174 N/A INTRINSIC
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 332 410 4.61e-10 PROSPERO
internal_repeat_1 404 476 4.61e-10 PROSPERO
low complexity region 497 514 N/A INTRINSIC
Pfam:PARP 712 839 2e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000223949
AA Change: S323T

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000225344
Predicted Effect probably benign
Transcript: ENSMUST00000226107
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 T A 5: 8,986,843 (GRCm39) V754D probably benign Het
Actn1 T A 12: 80,219,742 (GRCm39) M710L possibly damaging Het
Adam1a A G 5: 121,659,101 (GRCm39) F64S probably benign Het
Aip G T 19: 4,171,402 (GRCm39) D11E probably benign Het
Ak7 T A 12: 105,747,938 (GRCm39) Y714* probably null Het
Amhr2 A G 15: 102,362,799 (GRCm39) E522G possibly damaging Het
Amotl1 A G 9: 14,504,995 (GRCm39) L108P probably damaging Het
Arhgef17 A G 7: 100,528,184 (GRCm39) S677P probably benign Het
Asph T C 4: 9,630,604 (GRCm39) probably null Het
Atp11b T C 3: 35,895,185 (GRCm39) S908P probably benign Het
Atp13a3 C A 16: 30,157,308 (GRCm39) V903L possibly damaging Het
Bcam G A 7: 19,492,368 (GRCm39) R576* probably null Het
Btbd2 A G 10: 80,484,449 (GRCm39) S141P probably damaging Het
Cacna1b T C 2: 24,652,860 (GRCm39) N67S possibly damaging Het
Cc2d2b A G 19: 40,784,248 (GRCm39) T872A possibly damaging Het
Ccdc24 T A 4: 117,728,313 (GRCm39) I144F probably null Het
Cep44 A T 8: 56,997,234 (GRCm39) F101L possibly damaging Het
Cfap410 T A 10: 77,818,790 (GRCm39) C154S probably benign Het
Cimap1d T C 10: 79,475,790 (GRCm39) Y258C probably damaging Het
Disp1 C A 1: 182,869,030 (GRCm39) R1130L probably damaging Het
Dnajc21 G T 15: 10,461,493 (GRCm39) Y152* probably null Het
Edem2 A G 2: 155,557,992 (GRCm39) F214L possibly damaging Het
Fam118b G A 9: 35,135,014 (GRCm39) R198W probably damaging Het
Fgb A G 3: 82,953,371 (GRCm39) V133A probably benign Het
Fsip2 A G 2: 82,820,979 (GRCm39) T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 141,794,554 (GRCm39) probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,193,999 (GRCm39) probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,194,000 (GRCm39) probably benign Het
Hnf4a T A 2: 163,406,193 (GRCm39) Y277N probably damaging Het
Htatip2 A G 7: 49,420,583 (GRCm39) D143G possibly damaging Het
Itgae A G 11: 73,010,342 (GRCm39) N611D probably damaging Het
Ksr1 A T 11: 78,918,362 (GRCm39) N515K probably damaging Het
Lrp1 C A 10: 127,395,836 (GRCm39) probably null Het
Map3k20 T A 2: 72,208,979 (GRCm39) V195D probably damaging Het
Meox2 A G 12: 37,159,223 (GRCm39) S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Nell2 T A 15: 95,127,032 (GRCm39) N781I possibly damaging Het
Or12d16-ps1 G A 17: 37,706,094 (GRCm39) G221D possibly damaging Het
Or13a22 A G 7: 140,073,153 (GRCm39) T201A probably benign Het
Or51m1 A G 7: 103,578,737 (GRCm39) I236V probably benign Het
Or5e1 A G 7: 108,354,918 (GRCm39) N285S probably damaging Het
Otoa A T 7: 120,746,989 (GRCm39) Q918L probably damaging Het
Palld T G 8: 61,969,032 (GRCm39) K1022T probably damaging Het
Phrf1 A G 7: 140,817,476 (GRCm39) E95G probably damaging Het
Pls1 A T 9: 95,668,994 (GRCm39) F76I probably damaging Het
Pnp T A 14: 51,187,706 (GRCm39) probably null Het
Ptdss1 A C 13: 67,120,685 (GRCm39) M294L probably benign Het
Rictor T A 15: 6,804,361 (GRCm39) probably null Het
Rilp A G 11: 75,401,745 (GRCm39) E175G probably damaging Het
Serpina16 T A 12: 103,641,630 (GRCm39) T32S probably benign Het
Sim1 C T 10: 50,860,346 (GRCm39) S736L probably benign Het
Smarcc2 T G 10: 128,321,198 (GRCm39) probably null Het
Smtn A G 11: 3,480,368 (GRCm39) probably null Het
Sspo T A 6: 48,426,098 (GRCm39) W98R probably damaging Het
St8sia3 A T 18: 64,402,654 (GRCm39) I98F probably benign Het
Taf10 A T 7: 105,393,205 (GRCm39) probably null Het
Tasor2 A T 13: 3,626,857 (GRCm39) V1031E possibly damaging Het
Tbc1d4 T A 14: 101,724,877 (GRCm39) N580I probably damaging Het
Trim12c A T 7: 103,997,413 (GRCm39) C48S Het
Tsc22d1 C A 14: 76,654,982 (GRCm39) T405K probably damaging Het
Tubgcp5 A G 7: 55,443,977 (GRCm39) D2G possibly damaging Het
Wwc2 T C 8: 48,300,583 (GRCm39) E960G unknown Het
Yme1l1 T A 2: 23,076,367 (GRCm39) probably null Het
Zbtb2 G C 10: 4,318,646 (GRCm39) P460R probably damaging Het
Zfp62 T G 11: 49,106,764 (GRCm39) I285S probably damaging Het
Other mutations in Parp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Parp8 APN 13 117,063,859 (GRCm39) missense probably damaging 1.00
IGL01346:Parp8 APN 13 117,031,600 (GRCm39) missense possibly damaging 0.72
IGL01793:Parp8 APN 13 117,047,415 (GRCm39) missense probably damaging 1.00
IGL01926:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL01958:Parp8 APN 13 117,013,108 (GRCm39) missense probably benign 0.14
IGL02131:Parp8 APN 13 117,047,409 (GRCm39) missense probably benign 0.08
IGL02398:Parp8 APN 13 117,047,399 (GRCm39) critical splice donor site probably null
IGL02496:Parp8 APN 13 116,998,838 (GRCm39) splice site probably benign
IGL03135:Parp8 APN 13 117,047,478 (GRCm39) missense probably benign 0.41
IGL03143:Parp8 APN 13 117,047,497 (GRCm39) splice site probably benign
IGL03201:Parp8 APN 13 116,999,605 (GRCm39) splice site probably benign
blondi UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
Heidi UTSW 13 116,998,740 (GRCm39) splice site probably null
R0362:Parp8 UTSW 13 117,061,504 (GRCm39) nonsense probably null
R0699:Parp8 UTSW 13 117,059,120 (GRCm39) missense probably benign 0.01
R1445:Parp8 UTSW 13 117,161,886 (GRCm39) splice site probably null
R1676:Parp8 UTSW 13 117,014,064 (GRCm39) missense probably damaging 0.99
R1977:Parp8 UTSW 13 117,047,449 (GRCm39) missense probably damaging 0.96
R2019:Parp8 UTSW 13 117,004,968 (GRCm39) splice site probably benign
R2049:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2142:Parp8 UTSW 13 117,031,422 (GRCm39) missense probably benign 0.20
R2474:Parp8 UTSW 13 117,029,577 (GRCm39) missense possibly damaging 0.77
R2566:Parp8 UTSW 13 117,032,223 (GRCm39) missense possibly damaging 0.78
R3863:Parp8 UTSW 13 117,031,303 (GRCm39) missense probably benign 0.01
R4126:Parp8 UTSW 13 117,005,005 (GRCm39) missense possibly damaging 0.94
R4518:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4519:Parp8 UTSW 13 117,032,209 (GRCm39) missense possibly damaging 0.62
R4767:Parp8 UTSW 13 117,005,072 (GRCm39) missense probably damaging 0.99
R5355:Parp8 UTSW 13 116,998,740 (GRCm39) splice site probably null
R5633:Parp8 UTSW 13 117,013,116 (GRCm39) missense probably damaging 1.00
R5942:Parp8 UTSW 13 117,005,969 (GRCm39) missense probably benign 0.12
R5978:Parp8 UTSW 13 117,032,268 (GRCm39) missense probably benign 0.01
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6039:Parp8 UTSW 13 117,014,134 (GRCm39) missense probably damaging 1.00
R6753:Parp8 UTSW 13 117,031,651 (GRCm39) missense possibly damaging 0.91
R7139:Parp8 UTSW 13 117,161,802 (GRCm39) missense probably benign 0.21
R7305:Parp8 UTSW 13 117,031,461 (GRCm39) missense possibly damaging 0.95
R7314:Parp8 UTSW 13 117,004,996 (GRCm39) missense probably benign 0.01
R7360:Parp8 UTSW 13 117,032,307 (GRCm39) missense probably benign 0.02
R7526:Parp8 UTSW 13 117,031,341 (GRCm39) missense probably damaging 1.00
R8078:Parp8 UTSW 13 117,061,519 (GRCm39) missense probably damaging 1.00
R8108:Parp8 UTSW 13 117,003,609 (GRCm39) nonsense probably null
R8372:Parp8 UTSW 13 116,991,786 (GRCm39) missense probably damaging 1.00
R9005:Parp8 UTSW 13 117,013,126 (GRCm39) missense probably benign
R9072:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9073:Parp8 UTSW 13 117,047,951 (GRCm39) missense probably damaging 1.00
R9351:Parp8 UTSW 13 117,000,781 (GRCm39) missense probably damaging 0.99
R9441:Parp8 UTSW 13 117,029,562 (GRCm39) missense probably damaging 1.00
R9448:Parp8 UTSW 13 117,039,360 (GRCm39) nonsense probably null
R9470:Parp8 UTSW 13 117,031,292 (GRCm39) missense probably benign 0.02
R9562:Parp8 UTSW 13 117,029,631 (GRCm39) missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GGTCTCCAGAACAAGATCGAGTC -3'
(R):5'- GGAGTGGCCAACATTTGTCC -3'

Sequencing Primer
(F):5'- CGAGTCAATAACTTATGGGACTTCAG -3'
(R):5'- GCCAACATTTGTCCGGTGG -3'
Posted On 2019-05-13