Incidental Mutation 'R7016:Dnajc21'
ID545339
Institutional Source Beutler Lab
Gene Symbol Dnajc21
Ensembl Gene ENSMUSG00000044224
Gene NameDnaJ heat shock protein family (Hsp40) member C21
Synonyms9930116P15Rik, 4930461P20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.266) question?
Stock #R7016 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location10446756-10470516 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 10461407 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 152 (Y152*)
Ref Sequence ENSEMBL: ENSMUSP00000116865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000136591]
Predicted Effect probably null
Transcript: ENSMUST00000136591
AA Change: Y152*
SMART Domains Protein: ENSMUSP00000116865
Gene: ENSMUSG00000044224
AA Change: Y152*

DomainStartEndE-ValueType
DnaJ 2 61 7.2e-29 SMART
coiled coil region 178 283 N/A INTRINSIC
ZnF_U1 311 345 5.3e-8 SMART
ZnF_C2H2 314 338 1.67e-2 SMART
low complexity region 379 393 N/A INTRINSIC
low complexity region 452 470 N/A INTRINSIC
ZnF_C2H2 483 507 5.34e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 98% (63/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNAJ heat shock protein 40 family of proteins that is characterized by two N-terminal tetratricopeptide repeat domains and a C-terminal DNAJ domain. This protein binds the precursor 45S ribosomal RNA and may be involved in early nuclear ribosomal RNA biogenesis and maturation of the 60S ribosomal subunit. Mutations in this gene result in Bone marrow failure syndrome 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2017]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810043G02Rik T A 10: 77,982,956 C154S probably benign Het
Abcb4 T A 5: 8,936,843 V754D probably benign Het
Actn1 T A 12: 80,172,968 M710L possibly damaging Het
Adam1a A G 5: 121,521,038 F64S probably benign Het
Aip G T 19: 4,121,402 D11E probably benign Het
Ak7 T A 12: 105,781,679 Y714* probably null Het
Amhr2 A G 15: 102,454,364 E522G possibly damaging Het
Amotl1 A G 9: 14,593,699 L108P probably damaging Het
Arhgef17 A G 7: 100,878,977 S677P probably benign Het
Asph T C 4: 9,630,604 probably null Het
Atp11b T C 3: 35,841,036 S908P probably benign Het
Atp13a3 C A 16: 30,338,490 V903L possibly damaging Het
Bcam G A 7: 19,758,443 R576* probably null Het
Btbd2 A G 10: 80,648,615 S141P probably damaging Het
Cacna1b T C 2: 24,762,848 N67S possibly damaging Het
Cc2d2b A G 19: 40,795,804 T872A possibly damaging Het
Ccdc24 T A 4: 117,871,116 I144F probably null Het
Cep44 A T 8: 56,544,199 F101L possibly damaging Het
Disp1 C A 1: 183,087,466 R1130L probably damaging Het
Edem2 A G 2: 155,716,072 F214L possibly damaging Het
Fam118b G A 9: 35,223,718 R198W probably damaging Het
Fam208b A T 13: 3,576,857 V1031E possibly damaging Het
Fgb A G 3: 83,046,064 V133A probably benign Het
Fsip2 A G 2: 82,990,635 T5571A probably benign Het
Gm40460 CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG 7: 142,240,817 probably benign Het
Hjurp CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT C 1: 88,266,277 probably benign Het
Hjurp TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT TCT 1: 88,266,278 probably benign Het
Hnf4a T A 2: 163,564,273 Y277N probably damaging Het
Htatip2 A G 7: 49,770,835 D143G possibly damaging Het
Itgae A G 11: 73,119,516 N611D probably damaging Het
Ksr1 A T 11: 79,027,536 N515K probably damaging Het
Lrp1 C A 10: 127,559,967 probably null Het
Map3k20 T A 2: 72,378,635 V195D probably damaging Het
Meox2 A G 12: 37,109,224 S132G probably benign Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nell2 T A 15: 95,229,151 N781I possibly damaging Het
Odf3l2 T C 10: 79,639,956 Y258C probably damaging Het
Olfr106-ps G A 17: 37,395,203 G221D possibly damaging Het
Olfr513 A G 7: 108,755,711 N285S probably damaging Het
Olfr535 A G 7: 140,493,240 T201A probably benign Het
Olfr631 A G 7: 103,929,530 I236V probably benign Het
Otoa A T 7: 121,147,766 Q918L probably damaging Het
Palld T G 8: 61,515,998 K1022T probably damaging Het
Parp8 A T 13: 116,895,091 S362T probably damaging Het
Phrf1 A G 7: 141,237,563 E95G probably damaging Het
Pls1 A T 9: 95,786,941 F76I probably damaging Het
Pnp T A 14: 50,950,249 probably null Het
Ptdss1 A C 13: 66,972,621 M294L probably benign Het
Rictor T A 15: 6,774,880 probably null Het
Rilp A G 11: 75,510,919 E175G probably damaging Het
Serpina16 T A 12: 103,675,371 T32S probably benign Het
Sim1 C T 10: 50,984,250 S736L probably benign Het
Smarcc2 T G 10: 128,485,329 probably null Het
Smtn A G 11: 3,530,368 probably null Het
Sspo T A 6: 48,449,164 W98R probably damaging Het
St8sia3 A T 18: 64,269,583 I98F probably benign Het
Taf10 A T 7: 105,743,998 probably null Het
Tbc1d4 T A 14: 101,487,441 N580I probably damaging Het
Trim12c A T 7: 104,348,206 C48S Het
Tsc22d1 C A 14: 76,417,542 T405K probably damaging Het
Tubgcp5 A G 7: 55,794,229 D2G possibly damaging Het
Wwc2 T C 8: 47,847,548 E960G unknown Het
Yme1l1 T A 2: 23,186,355 probably null Het
Zbtb2 G C 10: 4,368,646 P460R probably damaging Het
Zfp62 T G 11: 49,215,937 I285S probably damaging Het
Other mutations in Dnajc21
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Dnajc21 APN 15 10447102 missense probably benign 0.01
IGL02797:Dnajc21 APN 15 10461355 missense probably damaging 0.96
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R0032:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R1480:Dnajc21 UTSW 15 10459951 splice site probably null
R1694:Dnajc21 UTSW 15 10451563 missense probably benign 0.00
R1777:Dnajc21 UTSW 15 10449607 missense probably benign 0.00
R2420:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2421:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R2422:Dnajc21 UTSW 15 10461935 missense probably benign 0.00
R4065:Dnajc21 UTSW 15 10451553 critical splice donor site probably null
R4182:Dnajc21 UTSW 15 10459933 intron probably null
R4546:Dnajc21 UTSW 15 10447097 missense probably benign 0.01
R4644:Dnajc21 UTSW 15 10463917 missense possibly damaging 0.89
R4939:Dnajc21 UTSW 15 10449597 missense probably damaging 0.96
R5075:Dnajc21 UTSW 15 10461877 missense probably benign 0.32
R5187:Dnajc21 UTSW 15 10463964 missense probably benign 0.21
R5273:Dnajc21 UTSW 15 10454807 missense probably damaging 1.00
R5590:Dnajc21 UTSW 15 10462277 missense possibly damaging 0.92
R5643:Dnajc21 UTSW 15 10461915 missense probably benign
R5644:Dnajc21 UTSW 15 10461915 missense probably benign
R5729:Dnajc21 UTSW 15 10449596 missense probably benign 0.01
R6614:Dnajc21 UTSW 15 10470263 critical splice donor site probably null
R6815:Dnajc21 UTSW 15 10447691 splice site probably null
R7076:Dnajc21 UTSW 15 10449631 missense probably benign
R7584:Dnajc21 UTSW 15 10462295 nonsense probably null
R7624:Dnajc21 UTSW 15 10461232 missense probably benign 0.07
R7624:Dnajc21 UTSW 15 10461234 missense probably damaging 0.98
R7676:Dnajc21 UTSW 15 10462344 missense possibly damaging 0.95
R7788:Dnajc21 UTSW 15 10460047 missense probably damaging 1.00
R7845:Dnajc21 UTSW 15 10447141 missense probably damaging 1.00
R7928:Dnajc21 UTSW 15 10447141 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAAGGCTACCAGCTGG -3'
(R):5'- AACTGCCTTCTTGTCCAGTG -3'

Sequencing Primer
(F):5'- GGCGCACCAGTTCATTTTTC -3'
(R):5'- GCCTTCTTGTCCAGTGATTGACG -3'
Posted On2019-05-13