Incidental Mutation 'R7017:Olfr1000'
ID545349
Institutional Source Beutler Lab
Gene Symbol Olfr1000
Ensembl Gene ENSMUSG00000075215
Gene Nameolfactory receptor 1000
SynonymsMOR175-9, GA_x6K02T2Q125-47087719-47086775
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location85607037-85611903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85608329 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 194 (M194L)
Ref Sequence ENSEMBL: ENSMUSP00000150731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099921] [ENSMUST00000213837] [ENSMUST00000216571]
Predicted Effect probably benign
Transcript: ENSMUST00000099921
AA Change: M194L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097505
Gene: ENSMUSG00000075215
AA Change: M194L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-49 PFAM
Pfam:7tm_1 41 290 2.9e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213837
AA Change: M194L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000216571
AA Change: M194L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Olfr1000
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1000 APN 2 85608761 missense probably benign
IGL01872:Olfr1000 APN 2 85608329 missense probably benign
IGL01955:Olfr1000 APN 2 85608707 missense probably benign 0.12
IGL02132:Olfr1000 APN 2 85608320 missense probably benign 0.00
IGL02139:Olfr1000 APN 2 85608230 nonsense probably null
IGL02717:Olfr1000 APN 2 85608772 missense probably damaging 1.00
IGL02950:Olfr1000 APN 2 85608157 missense possibly damaging 0.92
R1866:Olfr1000 UTSW 2 85608844 missense probably benign 0.05
R1868:Olfr1000 UTSW 2 85608065 missense probably damaging 0.98
R1869:Olfr1000 UTSW 2 85608500 missense probably benign 0.23
R2256:Olfr1000 UTSW 2 85608463 missense possibly damaging 0.81
R2919:Olfr1000 UTSW 2 85608410 missense probably benign 0.06
R4736:Olfr1000 UTSW 2 85607983 missense probably benign
R5197:Olfr1000 UTSW 2 85608447 missense probably benign 0.01
R5256:Olfr1000 UTSW 2 85608473 missense probably benign
R5367:Olfr1000 UTSW 2 85608374 missense probably damaging 0.99
R5389:Olfr1000 UTSW 2 85608283 missense probably benign
R6991:Olfr1000 UTSW 2 85608248 missense possibly damaging 0.76
R7020:Olfr1000 UTSW 2 85608632 missense probably benign 0.11
R7352:Olfr1000 UTSW 2 85608784 missense probably damaging 1.00
R7392:Olfr1000 UTSW 2 85608488 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AGAGTCCCATACAGGATAGCG -3'
(R):5'- GGTATGCAGCCATATGTAAGCC -3'

Sequencing Primer
(F):5'- TAGCGACAGTCACCAAGTG -3'
(R):5'- GCAGCCATATGTAAGCCCTTGC -3'
Posted On2019-05-13