Incidental Mutation 'R7017:Plcg1'
ID 545352
Institutional Source Beutler Lab
Gene Symbol Plcg1
Ensembl Gene ENSMUSG00000016933
Gene Name phospholipase C, gamma 1
Synonyms Cded, Plc-gamma1, Plcg-1, Plc-1
MMRRC Submission
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7017 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 160731300-160775760 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 160758097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 926 (I926F)
Ref Sequence ENSEMBL: ENSMUSP00000105088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103115] [ENSMUST00000109462] [ENSMUST00000151590]
AlphaFold Q62077
Predicted Effect probably damaging
Transcript: ENSMUST00000103115
AA Change: I926F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099404
Gene: ENSMUSG00000016933
AA Change: I926F

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109462
AA Change: I926F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105088
Gene: ENSMUSG00000016933
AA Change: I926F

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 240 318 5.2e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
PH 489 680 2.99e1 SMART
SH2 548 645 1.12e-30 SMART
SH2 666 747 3.78e-28 SMART
SH3 794 850 6.49e-16 SMART
PH 804 933 8.93e-2 SMART
PLCYc 953 1070 3.23e-73 SMART
C2 1089 1192 1.37e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143997
SMART Domains Protein: ENSMUSP00000115181
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
C2 1 104 3.15e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151590
SMART Domains Protein: ENSMUSP00000133771
Gene: ENSMUSG00000016933

DomainStartEndE-ValueType
PH 33 144 5.54e-7 SMART
Pfam:EF-hand_like 239 318 4.4e-8 PFAM
PLCXc 320 464 3.7e-91 SMART
Meta Mutation Damage Score 0.3088 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the formation of inositol 1,4,5-trisphosphate and diacylglycerol from phosphatidylinositol 4,5-bisphosphate. This reaction uses calcium as a cofactor and plays an important role in the intracellular transduction of receptor-mediated tyrosine kinase activators. For example, when activated by SRC, the encoded protein causes the Ras guanine nucleotide exchange factor RasGRP1 to translocate to the Golgi, where it activates Ras. Also, this protein has been shown to be a major substrate for heparin-binding growth factor 1 (acidic fibroblast growth factor)-activated tyrosine kinase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early embryonic lethality associated with arrested growth and/or abnormal hematopoiesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Plcg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Plcg1 APN 2 160757266 missense probably damaging 1.00
IGL00885:Plcg1 APN 2 160758083 missense probably benign 0.03
IGL01066:Plcg1 APN 2 160754398 missense probably damaging 1.00
IGL01356:Plcg1 APN 2 160753893 missense probably damaging 1.00
IGL01629:Plcg1 APN 2 160758010 missense possibly damaging 0.69
IGL01732:Plcg1 APN 2 160747779 missense probably damaging 0.97
IGL01754:Plcg1 APN 2 160761433 missense probably damaging 1.00
IGL02195:Plcg1 APN 2 160753926 missense possibly damaging 0.83
IGL02371:Plcg1 APN 2 160753507 missense probably damaging 0.99
IGL02671:Plcg1 APN 2 160755752 nonsense probably null
IGL03096:Plcg1 APN 2 160757206 splice site probably benign
IGL03129:Plcg1 APN 2 160774526 critical splice acceptor site probably null
IGL03139:Plcg1 APN 2 160748129 critical splice donor site probably null
IGL03211:Plcg1 APN 2 160759691 missense possibly damaging 0.82
suscepit UTSW 2 160753602 splice site probably null
IGL03047:Plcg1 UTSW 2 160754879 missense probably damaging 1.00
R0098:Plcg1 UTSW 2 160732000 missense probably damaging 1.00
R0390:Plcg1 UTSW 2 160752366 missense probably damaging 1.00
R0413:Plcg1 UTSW 2 160761429 missense probably damaging 1.00
R0650:Plcg1 UTSW 2 160753363 splice site probably benign
R0679:Plcg1 UTSW 2 160756910 missense probably damaging 1.00
R0709:Plcg1 UTSW 2 160751778 splice site probably null
R1719:Plcg1 UTSW 2 160753743 missense probably null 0.94
R1721:Plcg1 UTSW 2 160731920 missense probably damaging 0.99
R1727:Plcg1 UTSW 2 160748088 missense probably benign 0.00
R1978:Plcg1 UTSW 2 160752578 splice site probably null
R2277:Plcg1 UTSW 2 160755805 missense possibly damaging 0.48
R2698:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R3832:Plcg1 UTSW 2 160754437 missense possibly damaging 0.95
R4094:Plcg1 UTSW 2 160747841 missense probably damaging 0.98
R4260:Plcg1 UTSW 2 160751707 critical splice donor site probably null
R4622:Plcg1 UTSW 2 160747768 splice site probably benign
R4837:Plcg1 UTSW 2 160750986 missense probably benign 0.00
R4942:Plcg1 UTSW 2 160753589 splice site probably null
R5514:Plcg1 UTSW 2 160753355 critical splice donor site probably null
R5647:Plcg1 UTSW 2 160751668 missense probably benign 0.45
R5929:Plcg1 UTSW 2 160753602 splice site probably null
R6303:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6304:Plcg1 UTSW 2 160761463 missense possibly damaging 0.90
R6471:Plcg1 UTSW 2 160753710 missense probably benign 0.10
R6500:Plcg1 UTSW 2 160754567 missense probably damaging 1.00
R7113:Plcg1 UTSW 2 160748283 missense possibly damaging 0.78
R7137:Plcg1 UTSW 2 160753926 missense possibly damaging 0.83
R7155:Plcg1 UTSW 2 160754380 missense probably damaging 1.00
R7211:Plcg1 UTSW 2 160731874 missense probably benign 0.02
R7777:Plcg1 UTSW 2 160754603 missense possibly damaging 0.89
R7918:Plcg1 UTSW 2 160753665 missense probably damaging 1.00
R7934:Plcg1 UTSW 2 160774578 missense possibly damaging 0.53
R8309:Plcg1 UTSW 2 160753933 missense probably benign 0.00
R8344:Plcg1 UTSW 2 160747896 missense probably benign 0.00
R8377:Plcg1 UTSW 2 160754922 missense probably damaging 1.00
R8524:Plcg1 UTSW 2 160761467 critical splice donor site probably null
R8708:Plcg1 UTSW 2 160754553 splice site probably benign
R8831:Plcg1 UTSW 2 160747812 missense probably benign 0.02
R8936:Plcg1 UTSW 2 160748066 missense probably benign 0.02
R9414:Plcg1 UTSW 2 160761356 missense possibly damaging 0.80
R9466:Plcg1 UTSW 2 160754600 missense probably benign
R9608:Plcg1 UTSW 2 160755751 missense probably benign 0.02
R9755:Plcg1 UTSW 2 160731860 missense probably benign 0.27
Z1176:Plcg1 UTSW 2 160758127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGAGCCAGTGTCTATGGC -3'
(R):5'- CCATCACAATCCTGTCTTGAGTTTG -3'

Sequencing Primer
(F):5'- CCCAGGGTTTGCATATCAGATACG -3'
(R):5'- GTTCTTTTGGGTGCCTTATCTAAG -3'
Posted On 2019-05-13