Incidental Mutation 'R7017:Thbs3'
ID545359
Institutional Source Beutler Lab
Gene Symbol Thbs3
Ensembl Gene ENSMUSG00000028047
Gene Namethrombospondin 3
SynonymsThbs-3, TSP3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.857) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location89215180-89226837 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 89224415 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 698 (D698V)
Ref Sequence ENSEMBL: ENSMUSP00000112912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029682] [ENSMUST00000041142] [ENSMUST00000119084] [ENSMUST00000174126]
Predicted Effect probably damaging
Transcript: ENSMUST00000029682
AA Change: D735V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029682
Gene: ENSMUSG00000028047
AA Change: D735V

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 2.5e-22 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
EGF 417 456 1.99e0 SMART
Pfam:TSP_3 492 527 1e-12 PFAM
Pfam:TSP_3 551 586 2.2e-16 PFAM
Pfam:TSP_3 586 609 6.6e-7 PFAM
Pfam:TSP_3 610 647 2.6e-14 PFAM
Pfam:TSP_3 648 687 2.4e-10 PFAM
Pfam:TSP_3 688 723 4.2e-15 PFAM
Pfam:TSP_C 741 938 3.3e-99 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041142
SMART Domains Protein: ENSMUSP00000041963
Gene: ENSMUSG00000042784

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 30 46 N/A INTRINSIC
internal_repeat_2 48 106 4.93e-6 PROSPERO
internal_repeat_1 79 151 3.46e-38 PROSPERO
low complexity region 153 181 N/A INTRINSIC
internal_repeat_1 183 254 3.46e-38 PROSPERO
internal_repeat_2 192 259 4.93e-6 PROSPERO
low complexity region 277 292 N/A INTRINSIC
low complexity region 296 307 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
low complexity region 382 400 N/A INTRINSIC
SEA 412 528 6.2e-43 SMART
low complexity region 537 552 N/A INTRINSIC
Blast:SEA 557 624 2e-36 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000119084
AA Change: D698V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112912
Gene: ENSMUSG00000028047
AA Change: D698V

DomainStartEndE-ValueType
TSPN 21 193 4.71e-56 SMART
Pfam:COMP 226 270 8.2e-26 PFAM
EGF 277 315 8.19e-2 SMART
EGF_CA 316 369 6.91e-9 SMART
EGF_CA 370 413 1.38e-8 SMART
Pfam:TSP_3 455 490 4.4e-13 PFAM
Pfam:TSP_3 514 549 9.3e-17 PFAM
Pfam:TSP_3 549 572 2.8e-7 PFAM
Pfam:TSP_3 573 610 1.1e-14 PFAM
Pfam:TSP_3 611 650 1e-10 PFAM
Pfam:TSP_3 651 686 1.8e-15 PFAM
Pfam:TSP_C 704 904 7.9e-108 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000120337
Gene: ENSMUSG00000028047
AA Change: D42V

DomainStartEndE-ValueType
Pfam:TSP_3 1 31 5.8e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174126
SMART Domains Protein: ENSMUSP00000133291
Gene: ENSMUSG00000064068

DomainStartEndE-ValueType
Pfam:Tom37_C 1 74 7.6e-23 PFAM
Pfam:GST_C_3 7 143 7.3e-12 PFAM
Pfam:GST_C_2 26 137 2.8e-9 PFAM
Pfam:Tom37_C 61 129 6.2e-15 PFAM
low complexity region 159 169 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous null mice at a young age are heavier and exhibit femurs with increased periosteal and endocortical diameters, greater moments of inertia and increased bending strength and failure loads, with these defects no longer detected in older mice. Femoral heads show accelerated bone ossification. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Thbs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01838:Thbs3 APN 3 89219058 nonsense probably null
IGL02927:Thbs3 APN 3 89220207 missense probably damaging 0.98
IGL02980:Thbs3 UTSW 3 89223144 missense probably benign
R0648:Thbs3 UTSW 3 89216665 intron probably null
R0690:Thbs3 UTSW 3 89220165 missense possibly damaging 0.50
R1856:Thbs3 UTSW 3 89226406 missense probably damaging 1.00
R1928:Thbs3 UTSW 3 89217760 missense probably damaging 1.00
R2116:Thbs3 UTSW 3 89219392 missense probably damaging 1.00
R4600:Thbs3 UTSW 3 89224590 missense probably damaging 0.97
R4719:Thbs3 UTSW 3 89216840 missense probably damaging 1.00
R4947:Thbs3 UTSW 3 89226431 missense probably damaging 1.00
R4989:Thbs3 UTSW 3 89223102 intron probably benign
R5134:Thbs3 UTSW 3 89223102 intron probably benign
R5217:Thbs3 UTSW 3 89223164 critical splice donor site probably null
R5305:Thbs3 UTSW 3 89217976 intron probably benign
R5354:Thbs3 UTSW 3 89221377 missense probably damaging 1.00
R5444:Thbs3 UTSW 3 89223385 intron probably benign
R5569:Thbs3 UTSW 3 89219463 missense probably damaging 1.00
R5646:Thbs3 UTSW 3 89219098 missense probably damaging 1.00
R5801:Thbs3 UTSW 3 89224397 missense probably benign 0.15
R5886:Thbs3 UTSW 3 89220163 missense probably damaging 1.00
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6031:Thbs3 UTSW 3 89218094 missense probably damaging 0.99
R6943:Thbs3 UTSW 3 89224864 missense probably benign 0.01
R7352:Thbs3 UTSW 3 89225280 missense probably benign 0.03
R7570:Thbs3 UTSW 3 89219052 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTTGCTCAGGAGACAGGCC -3'
(R):5'- GAACAATTTCCATGCCCTGGG -3'

Sequencing Primer
(F):5'- CAGGCCTACTGGAGGGAGTG -3'
(R):5'- CCATGCCCTGGGGTTGATAAAG -3'
Posted On2019-05-13