Incidental Mutation 'R7017:Wwp1'
ID545364
Institutional Source Beutler Lab
Gene Symbol Wwp1
Ensembl Gene ENSMUSG00000041058
Gene NameWW domain containing E3 ubiquitin protein ligase 1
SynonymsTiul1, SDRP1, 8030445B08Rik, AIP5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location19608303-19708993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19623124 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 787 (Y787C)
Ref Sequence ENSEMBL: ENSMUSP00000103881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035982] [ENSMUST00000108246] [ENSMUST00000108250]
Predicted Effect probably damaging
Transcript: ENSMUST00000035982
AA Change: Y787C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041627
Gene: ENSMUSG00000041058
AA Change: Y787C

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108246
AA Change: Y787C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103881
Gene: ENSMUSG00000041058
AA Change: Y787C

DomainStartEndE-ValueType
C2 19 113 4.19e-9 SMART
low complexity region 221 232 N/A INTRINSIC
low complexity region 266 286 N/A INTRINSIC
WW 346 378 1.03e-14 SMART
WW 379 410 7.43e-12 SMART
WW 453 485 1.43e-13 SMART
WW 493 525 6.82e-11 SMART
HECTc 582 918 4.83e-177 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108250
SMART Domains Protein: ENSMUSP00000103885
Gene: ENSMUSG00000078772

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WW domain-containing proteins are found in all eukaryotes and play an important role in the regulation of a wide variety of cellular functions such as protein degradation, transcription, and RNA splicing. This gene encodes a protein which contains 4 tandem WW domains and a HECT (homologous to the E6-associated protein carboxyl terminus) domain. The encoded protein belongs to a family of NEDD4-like proteins, which are E3 ubiquitin-ligase molecules and regulate key trafficking decisions, including targeting of proteins to proteosomes or lysosomes. Alternative splicing of this gene generates at least 6 transcript variants; however, the full length nature of these transcripts has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased osteoblast differentiation of bone marrow-derived stromal cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Wwp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Wwp1 APN 4 19650360 missense probably benign
IGL00945:Wwp1 APN 4 19640193 critical splice donor site probably null
IGL01338:Wwp1 APN 4 19627636 missense probably damaging 1.00
IGL01960:Wwp1 APN 4 19662115 splice site probably benign
IGL02969:Wwp1 APN 4 19623200 missense probably damaging 1.00
IGL03137:Wwp1 APN 4 19678408 missense probably damaging 0.97
BB008:Wwp1 UTSW 4 19650114 critical splice donor site probably null
BB018:Wwp1 UTSW 4 19650114 critical splice donor site probably null
PIT4243001:Wwp1 UTSW 4 19638631 missense probably damaging 0.99
R0035:Wwp1 UTSW 4 19631116 missense probably damaging 1.00
R0109:Wwp1 UTSW 4 19641725 intron probably benign
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0240:Wwp1 UTSW 4 19641734 splice site probably null
R0391:Wwp1 UTSW 4 19627911 missense probably damaging 1.00
R0464:Wwp1 UTSW 4 19638763 intron probably benign
R1604:Wwp1 UTSW 4 19659709 missense probably benign
R1716:Wwp1 UTSW 4 19659698 missense probably benign 0.00
R1778:Wwp1 UTSW 4 19627892 nonsense probably null
R1832:Wwp1 UTSW 4 19650197 missense probably benign 0.33
R2073:Wwp1 UTSW 4 19662181 missense possibly damaging 0.89
R2094:Wwp1 UTSW 4 19650390 missense probably benign 0.00
R2228:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2229:Wwp1 UTSW 4 19641745 missense probably damaging 1.00
R2267:Wwp1 UTSW 4 19638618 missense probably damaging 1.00
R2334:Wwp1 UTSW 4 19662032 missense probably benign 0.07
R2349:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R3761:Wwp1 UTSW 4 19631085 missense probably damaging 1.00
R4062:Wwp1 UTSW 4 19638644 missense possibly damaging 0.72
R4731:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4732:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4733:Wwp1 UTSW 4 19661990 missense probably benign 0.00
R4838:Wwp1 UTSW 4 19662143 missense probably benign 0.31
R4936:Wwp1 UTSW 4 19638804 missense probably damaging 0.96
R5262:Wwp1 UTSW 4 19631057 missense probably damaging 1.00
R5340:Wwp1 UTSW 4 19638773 critical splice donor site probably null
R5847:Wwp1 UTSW 4 19662174 missense possibly damaging 0.95
R6492:Wwp1 UTSW 4 19650299 missense possibly damaging 0.94
R6602:Wwp1 UTSW 4 19641816 missense probably damaging 1.00
R6628:Wwp1 UTSW 4 19661963 splice site probably null
R7195:Wwp1 UTSW 4 19627908 missense possibly damaging 0.84
R7276:Wwp1 UTSW 4 19611782 missense probably damaging 1.00
R7450:Wwp1 UTSW 4 19640016 missense probably damaging 0.99
R7488:Wwp1 UTSW 4 19627660 missense probably damaging 0.99
R7617:Wwp1 UTSW 4 19662188 missense probably benign 0.00
R7707:Wwp1 UTSW 4 19627645 missense probably benign 0.31
R7812:Wwp1 UTSW 4 19639991 missense probably damaging 0.99
R7864:Wwp1 UTSW 4 19635328 missense probably damaging 1.00
R7931:Wwp1 UTSW 4 19650114 critical splice donor site probably null
R8006:Wwp1 UTSW 4 19650174 missense probably benign
R8851:Wwp1 UTSW 4 19643437 missense probably null 1.00
X0018:Wwp1 UTSW 4 19640261 missense probably benign 0.41
X0062:Wwp1 UTSW 4 19638794 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- ATACATGGTGGAGACTGCTG -3'
(R):5'- CATGCTTGTTGTATGCACATATTGG -3'

Sequencing Primer
(F):5'- AGGATCATGACTTCAAGGCCCG -3'
(R):5'- CAGTTTAATGACAGAATGGC -3'
Posted On2019-05-13