Incidental Mutation 'R7017:Lilra6'
ID545377
Institutional Source Beutler Lab
Gene Symbol Lilra6
Ensembl Gene ENSMUSG00000030427
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 6
SynonymsPira3, 7M1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.118) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location3908280-3915503 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3908708 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 317 (T317N)
Ref Sequence ENSEMBL: ENSMUSP00000145890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038176] [ENSMUST00000090689] [ENSMUST00000206077]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038176
AA Change: T657N

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000042636
Gene: ENSMUSG00000030427
AA Change: T657N

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 40 105 3.11e0 SMART
IG 129 315 4.53e-2 SMART
IG_like 237 302 1.54e-1 SMART
IG_like 328 415 1.79e1 SMART
IG_like 429 517 2.66e1 SMART
IG 529 618 8.59e-3 SMART
low complexity region 637 646 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000090689
AA Change: T619N

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088188
Gene: ENSMUSG00000030427
AA Change: T619N

DomainStartEndE-ValueType
low complexity region 8 17 N/A INTRINSIC
IG_like 34 118 7.25e0 SMART
IG_like 129 220 1.62e2 SMART
IG_like 290 377 1.79e1 SMART
IG_like 391 479 2.66e1 SMART
IG 491 580 8.59e-3 SMART
low complexity region 599 608 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000206077
AA Change: T317N

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Lilra6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Lilra6 APN 7 3911554 missense probably benign 0.04
IGL00569:Lilra6 APN 7 3914589 missense probably damaging 0.99
IGL00899:Lilra6 APN 7 3913057 missense probably damaging 1.00
IGL00955:Lilra6 APN 7 3911404 splice site probably benign
IGL01585:Lilra6 APN 7 3914499 missense probably benign 0.01
IGL02195:Lilra6 APN 7 3914550 missense probably benign 0.00
IGL02586:Lilra6 APN 7 3908820 missense probably benign 0.36
IGL02719:Lilra6 APN 7 3912992 missense possibly damaging 0.96
IGL03166:Lilra6 APN 7 3912627 missense possibly damaging 0.69
IGL03329:Lilra6 APN 7 3914648 splice site probably benign
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0233:Lilra6 UTSW 7 3914936 missense possibly damaging 0.69
R0423:Lilra6 UTSW 7 3914775 splice site probably benign
R0483:Lilra6 UTSW 7 3913139 missense probably benign 0.02
R0511:Lilra6 UTSW 7 3912785 missense possibly damaging 0.77
R1472:Lilra6 UTSW 7 3912719 missense probably damaging 1.00
R1560:Lilra6 UTSW 7 3911408 critical splice donor site probably null
R1584:Lilra6 UTSW 7 3912662 missense probably damaging 1.00
R1781:Lilra6 UTSW 7 3915067 missense probably benign 0.28
R2411:Lilra6 UTSW 7 3911454 missense probably damaging 1.00
R2420:Lilra6 UTSW 7 3914858 missense probably damaging 1.00
R4021:Lilra6 UTSW 7 3911418 missense probably benign 0.20
R4074:Lilra6 UTSW 7 3914890 missense probably benign 0.23
R4284:Lilra6 UTSW 7 3908804 missense possibly damaging 0.76
R4508:Lilra6 UTSW 7 3912029 nonsense probably null
R4894:Lilra6 UTSW 7 3912531 missense probably benign 0.01
R4977:Lilra6 UTSW 7 3914383 missense probably benign 0.01
R5048:Lilra6 UTSW 7 3915441 critical splice donor site probably null
R5164:Lilra6 UTSW 7 3914881 missense probably damaging 1.00
R5185:Lilra6 UTSW 7 3914636 missense probably benign 0.00
R5527:Lilra6 UTSW 7 3914587 start gained probably benign
R6281:Lilra6 UTSW 7 3911973 missense probably damaging 1.00
R6480:Lilra6 UTSW 7 3912933 missense probably damaging 1.00
R6512:Lilra6 UTSW 7 3914388 missense probably benign 0.06
R6565:Lilra6 UTSW 7 3915020 missense probably benign
R7095:Lilra6 UTSW 7 3913197 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAGGAAACAAAGGCTCCC -3'
(R):5'- TCCTCTCCAGGGACAACAAG -3'

Sequencing Primer
(F):5'- ACAAAGGCTCCCAGTATGTG -3'
(R):5'- ACAAGGGCCCTGGTTGGATG -3'
Posted On2019-05-13