Incidental Mutation 'R7017:Pdzd9'
ID545381
Institutional Source Beutler Lab
Gene Symbol Pdzd9
Ensembl Gene ENSMUSG00000030887
Gene NamePDZ domain containing 9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location120658731-120670343 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 120663002 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 79 (H79L)
Ref Sequence ENSEMBL: ENSMUSP00000033178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033176] [ENSMUST00000033178] [ENSMUST00000127845] [ENSMUST00000208635]
PDB Structure
The solution structure of RSGI RUH-020, a PDZ domain of hypothetical protein from mouse [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000033176
SMART Domains Protein: ENSMUSP00000033176
Gene: ENSMUSG00000030884

DomainStartEndE-ValueType
Pfam:Peptidase_M16 48 194 3.2e-33 PFAM
Pfam:Peptidase_M16_C 199 378 2.2e-26 PFAM
low complexity region 417 430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033178
AA Change: H79L

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033178
Gene: ENSMUSG00000030887
AA Change: H79L

DomainStartEndE-ValueType
PDZ 38 111 2.97e-8 SMART
low complexity region 231 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127845
Predicted Effect probably benign
Transcript: ENSMUST00000208635
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Pdzd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pdzd9 APN 7 120660271 missense possibly damaging 0.92
IGL01295:Pdzd9 APN 7 120668395 missense probably damaging 1.00
IGL02252:Pdzd9 APN 7 120663015 missense probably benign 0.00
IGL02393:Pdzd9 APN 7 120662983 nonsense probably null
R0826:Pdzd9 UTSW 7 120668401 missense probably damaging 0.99
R4130:Pdzd9 UTSW 7 120662869 missense possibly damaging 0.81
R4131:Pdzd9 UTSW 7 120662869 missense possibly damaging 0.81
R4820:Pdzd9 UTSW 7 120668396 missense probably damaging 1.00
R4915:Pdzd9 UTSW 7 120670168 missense possibly damaging 0.82
R5883:Pdzd9 UTSW 7 120668553 missense possibly damaging 0.60
R6283:Pdzd9 UTSW 7 120660226 missense possibly damaging 0.66
R6896:Pdzd9 UTSW 7 120662872 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTAAATCAGAACGTTGTGCCTCAC -3'
(R):5'- TTATCATGCTAAGAACACTCATGGC -3'

Sequencing Primer
(F):5'- ACAGGCCTGCGTTTCATAACATTG -3'
(R):5'- CTCATGGCAGAAGAGAGTGTTTGC -3'
Posted On2019-05-13