Incidental Mutation 'R7017:Tanc2'
ID545394
Institutional Source Beutler Lab
Gene Symbol Tanc2
Ensembl Gene ENSMUSG00000053580
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms5730590C14Rik, 3526402J09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location105589986-105929304 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105923108 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 1793 (I1793V)
Ref Sequence ENSEMBL: ENSMUSP00000097904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100330]
Predicted Effect probably benign
Transcript: ENSMUST00000089485
SMART Domains Protein: ENSMUSP00000086912
Gene: ENSMUSG00000053580

DomainStartEndE-ValueType
ANK 35 63 1.16e3 SMART
ANK 78 107 3.31e-1 SMART
ANK 111 140 7.71e-2 SMART
ANK 144 173 6.12e-5 SMART
ANK 177 206 8.99e-3 SMART
ANK 210 239 5.71e-5 SMART
ANK 243 272 2.11e2 SMART
Blast:TPR 289 322 3e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100330
AA Change: I1793V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000097904
Gene: ENSMUSG00000053580
AA Change: I1793V

DomainStartEndE-ValueType
low complexity region 32 50 N/A INTRINSIC
low complexity region 129 152 N/A INTRINSIC
low complexity region 362 375 N/A INTRINSIC
low complexity region 436 447 N/A INTRINSIC
low complexity region 823 834 N/A INTRINSIC
ANK 846 878 2.08e3 SMART
ANK 882 913 2.97e2 SMART
ANK 917 946 5.75e-1 SMART
ANK 950 979 8.62e1 SMART
ANK 990 1018 1.16e3 SMART
ANK 1033 1062 3.31e-1 SMART
ANK 1066 1095 7.71e-2 SMART
ANK 1099 1128 6.12e-5 SMART
ANK 1132 1161 8.99e-3 SMART
ANK 1165 1194 5.71e-5 SMART
ANK 1198 1227 2.11e2 SMART
TPR 1244 1277 3.89e1 SMART
TPR 1291 1324 3.61e-2 SMART
TPR 1325 1358 2.82e-4 SMART
low complexity region 1369 1406 N/A INTRINSIC
low complexity region 1533 1539 N/A INTRINSIC
low complexity region 1787 1802 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000123674
Gene: ENSMUSG00000053580
AA Change: I935V

DomainStartEndE-ValueType
ANK 15 46 2.97e2 SMART
ANK 50 79 5.75e-1 SMART
ANK 83 112 8.62e1 SMART
ANK 123 151 1.16e3 SMART
ANK 166 195 3.31e-1 SMART
ANK 199 228 7.71e-2 SMART
ANK 232 261 6.12e-5 SMART
ANK 265 294 8.99e-3 SMART
ANK 298 327 5.71e-5 SMART
ANK 331 360 3.44e1 SMART
TPR 387 420 3.89e1 SMART
TPR 434 467 3.61e-2 SMART
TPR 468 501 2.82e-4 SMART
low complexity region 512 549 N/A INTRINSIC
low complexity region 676 682 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector die prior to E12. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Tanc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Tanc2 APN 11 105923220 missense probably benign 0.28
IGL00688:Tanc2 APN 11 105798690 missense probably damaging 1.00
IGL00709:Tanc2 APN 11 105798795 missense probably damaging 1.00
IGL01013:Tanc2 APN 11 105625065 missense probably damaging 0.96
IGL01141:Tanc2 APN 11 105886474 splice site probably benign
IGL01386:Tanc2 APN 11 105886381 missense probably damaging 0.99
IGL01433:Tanc2 APN 11 105810522 missense possibly damaging 0.75
IGL01562:Tanc2 APN 11 105780069 missense probably benign 0.00
IGL01979:Tanc2 APN 11 105776920 missense probably benign
IGL02104:Tanc2 APN 11 105780133 unclassified probably benign
IGL02434:Tanc2 APN 11 105780042 missense probably benign 0.14
IGL02534:Tanc2 APN 11 105835168 missense probably damaging 1.00
IGL02568:Tanc2 APN 11 105776951 missense probably benign 0.00
IGL03279:Tanc2 APN 11 105913092 splice site probably null
R0595:Tanc2 UTSW 11 105714177 splice site probably null
R1131:Tanc2 UTSW 11 105835002 missense probably damaging 1.00
R1320:Tanc2 UTSW 11 105886444 missense probably damaging 1.00
R1487:Tanc2 UTSW 11 105923634 missense probably damaging 0.99
R1497:Tanc2 UTSW 11 105922137 missense probably benign 0.21
R1692:Tanc2 UTSW 11 105857500 missense probably benign
R1712:Tanc2 UTSW 11 105899780 missense probably benign
R1793:Tanc2 UTSW 11 105625033 critical splice acceptor site probably null
R1812:Tanc2 UTSW 11 105886386 missense probably benign 0.01
R1905:Tanc2 UTSW 11 105922863 missense possibly damaging 0.61
R1959:Tanc2 UTSW 11 105910295 missense probably damaging 1.00
R1962:Tanc2 UTSW 11 105798732 missense probably benign 0.14
R2122:Tanc2 UTSW 11 105895949 missense probably damaging 1.00
R2174:Tanc2 UTSW 11 105910309 missense probably benign 0.00
R2341:Tanc2 UTSW 11 105835051 missense probably benign 0.09
R2497:Tanc2 UTSW 11 105673493 critical splice donor site probably null
R3438:Tanc2 UTSW 11 105857575 missense probably damaging 0.97
R3711:Tanc2 UTSW 11 105798690 missense probably damaging 1.00
R3765:Tanc2 UTSW 11 105914970 missense probably damaging 1.00
R3890:Tanc2 UTSW 11 105798678 missense probably damaging 1.00
R4193:Tanc2 UTSW 11 105914062 intron probably benign
R4609:Tanc2 UTSW 11 105910240 missense probably benign 0.24
R4674:Tanc2 UTSW 11 105867480 missense probably damaging 1.00
R4928:Tanc2 UTSW 11 105867762 missense probably damaging 1.00
R5008:Tanc2 UTSW 11 105625060 start codon destroyed probably null 0.46
R5010:Tanc2 UTSW 11 105780092 missense probably damaging 1.00
R5135:Tanc2 UTSW 11 105857553 missense possibly damaging 0.93
R5385:Tanc2 UTSW 11 105776846 missense probably damaging 0.99
R5409:Tanc2 UTSW 11 105867485 missense possibly damaging 0.93
R5419:Tanc2 UTSW 11 105922883 missense probably benign 0.00
R5501:Tanc2 UTSW 11 105914985 critical splice donor site probably null
R5590:Tanc2 UTSW 11 105923306 missense probably damaging 0.99
R5651:Tanc2 UTSW 11 105798700 missense probably benign 0.44
R5798:Tanc2 UTSW 11 105921855 small deletion probably benign
R5876:Tanc2 UTSW 11 105922613 missense possibly damaging 0.71
R5889:Tanc2 UTSW 11 105921807 missense probably benign 0.23
R5958:Tanc2 UTSW 11 105840625 missense probably benign 0.00
R5999:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6024:Tanc2 UTSW 11 105923672 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6025:Tanc2 UTSW 11 105896547 missense possibly damaging 0.68
R6048:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6049:Tanc2 UTSW 11 105867717 missense probably damaging 1.00
R6185:Tanc2 UTSW 11 105913039 missense probably damaging 1.00
R6335:Tanc2 UTSW 11 105857556 missense probably damaging 0.99
R6821:Tanc2 UTSW 11 105886490 intron probably null
R6846:Tanc2 UTSW 11 105798653 missense probably benign 0.34
R6857:Tanc2 UTSW 11 105910288 missense possibly damaging 0.81
R6904:Tanc2 UTSW 11 105835230 missense possibly damaging 0.89
R7009:Tanc2 UTSW 11 105840699 missense possibly damaging 0.47
R7371:Tanc2 UTSW 11 105798596 missense probably benign
R7556:Tanc2 UTSW 11 105909031 missense
R7630:Tanc2 UTSW 11 105776908 missense probably benign 0.04
R7693:Tanc2 UTSW 11 105923467 missense probably damaging 1.00
X0027:Tanc2 UTSW 11 105835183 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AAAACTAGATCTGGAGCGTTCCTC -3'
(R):5'- TCCGATTCTGCTGGTGAAGG -3'

Sequencing Primer
(F):5'- AGCGTTCCTCCAGCCAG -3'
(R):5'- TCTATGATCCCCATGAATGGTG -3'
Posted On2019-05-13