Incidental Mutation 'R7017:Hbp1'
ID545395
Institutional Source Beutler Lab
Gene Symbol Hbp1
Ensembl Gene ENSMUSG00000002996
Gene Namehigh mobility group box transcription factor 1
Synonyms1700058O05Rik, C86454, C330012F01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.865) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31926254-31950535 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31943853 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 59 (S59P)
Ref Sequence ENSEMBL: ENSMUSP00000135508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167458] [ENSMUST00000172314] [ENSMUST00000175686] [ENSMUST00000176084] [ENSMUST00000176103] [ENSMUST00000176520]
Predicted Effect probably damaging
Transcript: ENSMUST00000167458
AA Change: S59P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131983
Gene: ENSMUSG00000002996
AA Change: S59P

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
AXH 220 350 1.35e-88 SMART
PDB:1S5R|A 368 390 6e-7 PDB
low complexity region 406 424 N/A INTRINSIC
PDB:2E6O|A 437 474 6e-20 PDB
SCOP:d1cg7a_ 443 474 2e-9 SMART
Blast:HMG 445 474 3e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000172314
AA Change: S59P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131158
Gene: ENSMUSG00000002996
AA Change: S59P

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
AXH 220 350 1.35e-88 SMART
PDB:1S5R|A 368 390 7e-7 PDB
low complexity region 406 424 N/A INTRINSIC
HMG 445 515 8.7e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175686
AA Change: S63P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135080
Gene: ENSMUSG00000002996
AA Change: S63P

DomainStartEndE-ValueType
low complexity region 166 180 N/A INTRINSIC
AXH 224 354 1.35e-88 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176084
AA Change: S49P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135489
Gene: ENSMUSG00000002996
AA Change: S49P

DomainStartEndE-ValueType
low complexity region 152 166 N/A INTRINSIC
PDB:3QVE|C 206 230 7e-10 PDB
Blast:AXH 210 230 2e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176103
AA Change: S59P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135508
Gene: ENSMUSG00000002996
AA Change: S59P

DomainStartEndE-ValueType
low complexity region 162 176 N/A INTRINSIC
PDB:1V06|A 218 265 1e-28 PDB
Blast:AXH 220 265 1e-25 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000176520
AA Change: S49P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000135155
Gene: ENSMUSG00000002996
AA Change: S49P

DomainStartEndE-ValueType
low complexity region 152 166 N/A INTRINSIC
Pfam:AXH 215 288 3.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176643
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
MGI Phenotype PHENOTYPE: Mice heterozygous for a gene trapped allele have behavioral abnormalities and show alterations in leukocyte, platelet and NK cell number, blood urea nitrogen levels, and circulating amylase and calcium levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fbxo40 T C 16: 36,970,370 D126G probably damaging Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Hbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02114:Hbp1 APN 12 31930675 unclassified probably benign
Sliver UTSW 12 31937247 missense probably damaging 0.99
R4135:Hbp1 UTSW 12 31934422 missense probably damaging 1.00
R4569:Hbp1 UTSW 12 31950232 unclassified probably benign
R5324:Hbp1 UTSW 12 31928618 missense probably damaging 1.00
R5910:Hbp1 UTSW 12 31937652 missense probably benign 0.19
R5936:Hbp1 UTSW 12 31937096 splice site probably null
R6062:Hbp1 UTSW 12 31937247 missense probably damaging 0.99
R6439:Hbp1 UTSW 12 31937721 missense probably damaging 1.00
R7213:Hbp1 UTSW 12 31937197 missense probably benign 0.00
R7519:Hbp1 UTSW 12 31933375 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGCACATGCTACACCTG -3'
(R):5'- GTCACATGACACTGCCTTTC -3'

Sequencing Primer
(F):5'- ATGCTACACCTGCACCTGC -3'
(R):5'- CTTTCATTTCTAGTCGGAGCAC -3'
Posted On2019-05-13