Mutagenetix > Incidental Mutations

Incidental Mutation 'R7017:Cacna1i'

545407

Institutional Source

Beutler Lab

Gene Symbol

Cacna1i

Ensembl Gene

ENSMUSG00000022416

Gene Name

calcium channel, voltage-dependent, alpha 1I subunit

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7017 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80287238-80398279 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 80380470 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 1500 (F1500L)

Ref Sequence

ENSEMBL: ENSMUSP00000125229 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]

Predicted Effect

probably benign
Transcript: ENSMUST00000160424
AA Change: F1500L

PolyPhen 2 Score 0.423 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: F1500L

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	76	407	1.4e-79	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	597	830	7.4e-58	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1128	1401	7.8e-65	PFAM
Pfam:Ion_trans	1445	1700	9.4e-58	PFAM
Pfam:PKD_channel	1538	1694	1.4e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC
low complexity region	1837	1853	N/A	INTRINSIC
low complexity region	1922	1933	N/A	INTRINSIC
low complexity region	1990	2005	N/A	INTRINSIC
low complexity region	2041	2058	N/A	INTRINSIC
low complexity region	2087	2097	N/A	INTRINSIC
low complexity region	2103	2126	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162155
AA Change: F1500L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: F1500L

Domain	Start	End	E-Value	Type
low complexity region	2	16	N/A	INTRINSIC
low complexity region	24	40	N/A	INTRINSIC
Pfam:Ion_trans	115	395	1.9e-66	PFAM
low complexity region	464	482	N/A	INTRINSIC
low complexity region	531	554	N/A	INTRINSIC
Pfam:Ion_trans	632	819	2.4e-45	PFAM
low complexity region	870	892	N/A	INTRINSIC
low complexity region	919	940	N/A	INTRINSIC
low complexity region	984	1015	N/A	INTRINSIC
low complexity region	1069	1080	N/A	INTRINSIC
Pfam:Ion_trans	1165	1389	6.2e-55	PFAM
coiled coil region	1394	1426	N/A	INTRINSIC
Pfam:Ion_trans	1480	1688	1.9e-47	PFAM
Pfam:PKD_channel	1538	1694	4.8e-10	PFAM
low complexity region	1718	1739	N/A	INTRINSIC
low complexity region	1744	1760	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (75/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	A	G	17: 36,978,034		probably benign	Het
Acot3	A	T	12: 84,053,303		probably benign	Het
Add3	T	A	19: 53,233,853	V297E	possibly damaging	Het
Arfgap1	C	G	2: 180,976,304		probably null	Het
C530008M17Rik	GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG	GAGACAACGCGAGGCCGAGAGGCAGG	5: 76,856,948		probably benign	Het
Cacna1s	T	C	1: 136,095,858	I945T	probably damaging	Het
Ccdc180	T	A	4: 45,940,934	N1334K	possibly damaging	Het
Cd5l	C	A	3: 87,366,061	Y112*	probably null	Het
Cyp2d40	A	T	15: 82,760,033	F297Y	unknown	Het
Ddx4	C	T	13: 112,601,488	V546I	probably damaging	Het
Dgkg	T	C	16: 22,572,713	M332V	probably benign	Het
Dnah12	T	C	14: 26,735,680	I867T	probably benign	Het
Dnah2	T	A	11: 69,491,547	K1246*	probably null	Het
Drd2	G	A	9: 49,400,829	V161I	probably benign	Het
Dsp	A	G	13: 38,186,707	D862G	probably benign	Het
Ephx4	T	C	5: 107,406,114	F10S	probably damaging	Het
Fabp9	C	A	3: 10,194,696	A76S	possibly damaging	Het
Fam198a	T	C	9: 121,965,986		probably null	Het
Fam46b	T	C	4: 133,486,234	S139P	possibly damaging	Het
Fat4	G	A	3: 38,891,543	M1528I	probably benign	Het
Fbxl12	A	G	9: 20,618,320	S84P	unknown	Het
Fbxo40	T	C	16: 36,970,370	D126G	probably damaging	Het
Fpr1	C	T	17: 17,877,392	V112I	probably benign	Het
Frem2	T	C	3: 53,519,602	N2975S	probably benign	Het
Gm7945	T	C	14: 41,383,653	Y156C		Het
Gnpat	T	C	8: 124,863,275	V13A	probably benign	Het
Gpx5	G	A	13: 21,291,391	P55L	probably damaging	Het
Hbp1	A	G	12: 31,943,853	S59P	probably damaging	Het
Ighv1-36	T	A	12: 114,879,913	D109V	probably damaging	Het
Iqcf5	T	A	9: 106,515,664	I40N	possibly damaging	Het
Kcnma1	T	G	14: 23,494,643	I484L	possibly damaging	Het
Kera	A	T	10: 97,609,077	R99S	possibly damaging	Het
Kif3b	T	A	2: 153,329,724	S707R	possibly damaging	Het
Lilra6	G	T	7: 3,908,708	T317N	possibly damaging	Het
Lrrc15	C	T	16: 30,272,962	E520K	probably benign	Het
Lrrc34	C	T	3: 30,645,316		probably null	Het
Lvrn	A	G	18: 46,850,678	T163A	probably benign	Het
Met	T	A	6: 17,491,287	L16*	probably null	Het
Mpzl2	G	T	9: 45,047,289	D108Y	probably benign	Het
Mrgprb2	T	A	7: 48,552,837	I47F	probably benign	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Mybphl	T	A	3: 108,374,838	V128E	probably damaging	Het
Nckap5	A	T	1: 126,102,661	D231E	probably damaging	Het
Olfr1000	T	A	2: 85,608,329	M194L	probably benign	Het
Orm1	T	A	4: 63,345,211	I87K	probably benign	Het
Pdgfrb	C	T	18: 61,081,004	P954S	probably benign	Het
Pdzd8	G	T	19: 59,345,352	S79*	probably null	Het
Pdzd9	T	A	7: 120,663,002	H79L	probably benign	Het
Plcg1	A	T	2: 160,758,097	I926F	probably damaging	Het
Plec	A	T	15: 76,173,541	F4078L	probably damaging	Het
Plek	G	A	11: 17,052,220		probably benign	Het
Pogz	T	C	3: 94,854,024	I25T	probably damaging	Het
Ppfia3	A	T	7: 45,358,800	D215E	probably benign	Het
Psg22	C	A	7: 18,724,441	S352R	probably benign	Het
Ptchd4	A	G	17: 42,502,735	Y509C	probably damaging	Het
Ralgapb	C	A	2: 158,448,337	N389K	probably benign	Het
Rdh1	A	G	10: 127,763,037	D129G	probably benign	Het
Rimbp3	A	G	16: 17,209,746	T345A	probably benign	Het
S100a14	T	C	3: 90,527,295		probably null	Het
Scamp1	T	A	13: 94,224,915	R152S	probably damaging	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Srf	T	C	17: 46,550,904	T383A	probably benign	Het
St6galnac5	T	C	3: 152,846,403	M176V	probably damaging	Het
St8sia1	C	A	6: 142,867,906	V177F	probably damaging	Het
Syt12	C	T	19: 4,460,867		probably null	Het
Tanc2	A	G	11: 105,923,108	I1793V	probably benign	Het
Tas2r123	A	G	6: 132,847,550	I137V	probably benign	Het
Tenm2	T	A	11: 36,171,409	Y543F	probably damaging	Het
Tgfbr1	T	C	4: 47,410,728	I488T	probably damaging	Het
Tgm1	T	A	14: 55,704,941	Y651F	possibly damaging	Het
Thbs3	A	T	3: 89,224,415	D698V	probably damaging	Het
Tpra1	T	A	6: 88,908,312	I82N	probably damaging	Het
Ubr4	T	A	4: 139,393,090	D275E	probably damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wwp1	T	C	4: 19,623,124	Y787C	probably damaging	Het
Znfx1	T	C	2: 167,048,534	S677G	probably damaging	Het

Other mutations in Cacna1i

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00421:Cacna1i	APN	15	80382019	missense	probably damaging	1.00
IGL00976:Cacna1i	APN	15	80355645	missense	probably benign
IGL01338:Cacna1i	APN	15	80348380	missense	probably damaging	0.99
IGL01589:Cacna1i	APN	15	80387759	splice site	probably benign
IGL01669:Cacna1i	APN	15	80391757	missense	probably benign
IGL01807:Cacna1i	APN	15	80374147	missense	probably damaging	1.00
IGL01911:Cacna1i	APN	15	80391732	missense	probably benign	0.09
IGL01973:Cacna1i	APN	15	80382033	missense	probably damaging	1.00
IGL02205:Cacna1i	APN	15	80372951	missense	probably benign	0.06
IGL02519:Cacna1i	APN	15	80361874	nonsense	probably null
IGL02648:Cacna1i	APN	15	80298638	missense	probably damaging	0.96
IGL03033:Cacna1i	APN	15	80362239	missense	probably damaging	0.98
IGL03214:Cacna1i	APN	15	80355716	missense	probably benign	0.30
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0067:Cacna1i	UTSW	15	80381172	missense	probably damaging	1.00
R0295:Cacna1i	UTSW	15	80356211	missense	probably damaging	1.00
R0345:Cacna1i	UTSW	15	80372462	missense	probably damaging	0.98
R0415:Cacna1i	UTSW	15	80368830	splice site	probably benign
R0637:Cacna1i	UTSW	15	80372654	missense	probably damaging	0.99
R0638:Cacna1i	UTSW	15	80381080	missense	possibly damaging	0.94
R0840:Cacna1i	UTSW	15	80358949	missense	possibly damaging	0.85
R1463:Cacna1i	UTSW	15	80379054	missense	possibly damaging	0.96
R1528:Cacna1i	UTSW	15	80391774	splice site	probably null
R1563:Cacna1i	UTSW	15	80321188	missense	probably damaging	0.97
R1563:Cacna1i	UTSW	15	80389855	splice site	probably benign
R1573:Cacna1i	UTSW	15	80393668	splice site	probably null
R1654:Cacna1i	UTSW	15	80389210	missense	probably damaging	1.00
R1754:Cacna1i	UTSW	15	80371529	missense	probably damaging	0.99
R1794:Cacna1i	UTSW	15	80389122	missense	probably damaging	1.00
R1824:Cacna1i	UTSW	15	80376789	missense	possibly damaging	0.64
R1863:Cacna1i	UTSW	15	80358931	missense	probably damaging	1.00
R1885:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1886:Cacna1i	UTSW	15	80358944	missense	probably damaging	0.99
R1899:Cacna1i	UTSW	15	80391642	missense	possibly damaging	0.91
R1907:Cacna1i	UTSW	15	80375264	missense	probably damaging	1.00
R1943:Cacna1i	UTSW	15	80395044	missense	probably benign
R2162:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R2888:Cacna1i	UTSW	15	80374767	missense	probably damaging	1.00
R3701:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3702:Cacna1i	UTSW	15	80381071	splice site	probably benign
R3832:Cacna1i	UTSW	15	80356187	missense	probably damaging	1.00
R4852:Cacna1i	UTSW	15	80388479	missense	probably damaging	0.99
R4857:Cacna1i	UTSW	15	80369662	missense	probably damaging	1.00
R4950:Cacna1i	UTSW	15	80368671	missense	probably damaging	1.00
R4980:Cacna1i	UTSW	15	80348449	missense	probably damaging	0.97
R5217:Cacna1i	UTSW	15	80390840	missense	possibly damaging	0.94
R5437:Cacna1i	UTSW	15	80371529	missense	probably damaging	1.00
R5519:Cacna1i	UTSW	15	80371499	missense	probably damaging	1.00
R5642:Cacna1i	UTSW	15	80395078	missense	possibly damaging	0.47
R6217:Cacna1i	UTSW	15	80389132	missense	probably damaging	1.00
R6225:Cacna1i	UTSW	15	80321226	missense	probably damaging	1.00
R6251:Cacna1i	UTSW	15	80336682	missense	probably damaging	1.00
R6463:Cacna1i	UTSW	15	80355758	missense	probably damaging	0.97
R6490:Cacna1i	UTSW	15	80378247	missense	probably damaging	1.00
R6613:Cacna1i	UTSW	15	80321259	missense	probably damaging	1.00
R6884:Cacna1i	UTSW	15	80374809	missense	probably damaging	1.00
R6904:Cacna1i	UTSW	15	80374801	missense	probably damaging	1.00
R7155:Cacna1i	UTSW	15	80395238	missense	probably benign	0.04
R7274:Cacna1i	UTSW	15	80376822	missense	possibly damaging	0.95
R7323:Cacna1i	UTSW	15	80391653	missense	possibly damaging	0.86
R7335:Cacna1i	UTSW	15	80375575	missense	probably damaging	1.00
R7571:Cacna1i	UTSW	15	80375336	missense	probably damaging	1.00
R7768:Cacna1i	UTSW	15	80381188	missense	probably damaging	1.00
R7820:Cacna1i	UTSW	15	80372372	missense	probably benign	0.00
R7987:Cacna1i	UTSW	15	80320352	splice site	probably null
R8150:Cacna1i	UTSW	15	80375339	missense	probably damaging	1.00
R8206:Cacna1i	UTSW	15	80389815	splice site	probably null
R8270:Cacna1i	UTSW	15	80373634	missense	probably damaging	0.99
R8382:Cacna1i	UTSW	15	80376816	missense	probably damaging	0.99
R8501:Cacna1i	UTSW	15	80382046	critical splice donor site	probably null
R8518:Cacna1i	UTSW	15	80358894	nonsense	probably null
R8552:Cacna1i	UTSW	15	80320397	missense	possibly damaging	0.69
X0022:Cacna1i	UTSW	15	80361962	missense	probably damaging	0.99
X0024:Cacna1i	UTSW	15	80362139	missense	probably benign	0.03
X0058:Cacna1i	UTSW	15	80379102	missense	probably damaging	1.00
Z1177:Cacna1i	UTSW	15	80381179	missense	possibly damaging	0.64
Z1177:Cacna1i	UTSW	15	80389383	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TCAGGCTAGCACAGATGAGG -3'
(R):5'- ATCCATTCACTGTGACTTAATCGC -3'

Sequencing Primer
(F):5'- AGCGATGTGAAATGACTTAACAC -3'
(R):5'- CCTCTTGTCTGGGAATGTAGTCAAC -3'

Posted On

2019-05-13