Incidental Mutation 'R7017:Fbxo40'
ID545412
Institutional Source Beutler Lab
Gene Symbol Fbxo40
Ensembl Gene ENSMUSG00000047746
Gene NameF-box protein 40
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7017 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location36963460-36990467 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36970370 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 126 (D126G)
Ref Sequence ENSEMBL: ENSMUSP00000110454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075869] [ENSMUST00000114806]
Predicted Effect probably damaging
Transcript: ENSMUST00000075869
AA Change: D126G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075266
Gene: ENSMUSG00000047746
AA Change: D126G

DomainStartEndE-ValueType
Pfam:zf-TRAF_2 12 104 6.1e-42 PFAM
Pfam:F-box_4 571 686 1.2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114806
AA Change: D126G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110454
Gene: ENSMUSG00000047746
AA Change: D126G

DomainStartEndE-ValueType
PDB:2YRE|A 12 92 1e-27 PDB
SCOP:d1k2fa_ 62 97 5e-4 SMART
Blast:FBOX 578 616 1e-8 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the F-box protein family, such as FBXO40, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410137M14Rik A G 17: 36,978,034 probably benign Het
Acot3 A T 12: 84,053,303 probably benign Het
Add3 T A 19: 53,233,853 V297E possibly damaging Het
Arfgap1 C G 2: 180,976,304 probably null Het
C530008M17Rik GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG GAGACAACGCGAGGCCGAGAGGCAGG 5: 76,856,948 probably benign Het
Cacna1i T C 15: 80,380,470 F1500L probably damaging Het
Cacna1s T C 1: 136,095,858 I945T probably damaging Het
Ccdc180 T A 4: 45,940,934 N1334K possibly damaging Het
Cd5l C A 3: 87,366,061 Y112* probably null Het
Cyp2d40 A T 15: 82,760,033 F297Y unknown Het
Ddx4 C T 13: 112,601,488 V546I probably damaging Het
Dgkg T C 16: 22,572,713 M332V probably benign Het
Dnah12 T C 14: 26,735,680 I867T probably benign Het
Dnah2 T A 11: 69,491,547 K1246* probably null Het
Drd2 G A 9: 49,400,829 V161I probably benign Het
Dsp A G 13: 38,186,707 D862G probably benign Het
Ephx4 T C 5: 107,406,114 F10S probably damaging Het
Fabp9 C A 3: 10,194,696 A76S possibly damaging Het
Fam198a T C 9: 121,965,986 probably null Het
Fam46b T C 4: 133,486,234 S139P possibly damaging Het
Fat4 G A 3: 38,891,543 M1528I probably benign Het
Fbxl12 A G 9: 20,618,320 S84P unknown Het
Fpr1 C T 17: 17,877,392 V112I probably benign Het
Frem2 T C 3: 53,519,602 N2975S probably benign Het
Gm7945 T C 14: 41,383,653 Y156C Het
Gnpat T C 8: 124,863,275 V13A probably benign Het
Gpx5 G A 13: 21,291,391 P55L probably damaging Het
Hbp1 A G 12: 31,943,853 S59P probably damaging Het
Ighv1-36 T A 12: 114,879,913 D109V probably damaging Het
Iqcf5 T A 9: 106,515,664 I40N possibly damaging Het
Kcnma1 T G 14: 23,494,643 I484L possibly damaging Het
Kera A T 10: 97,609,077 R99S possibly damaging Het
Kif3b T A 2: 153,329,724 S707R possibly damaging Het
Lilra6 G T 7: 3,908,708 T317N possibly damaging Het
Lrrc15 C T 16: 30,272,962 E520K probably benign Het
Lrrc34 C T 3: 30,645,316 probably null Het
Lvrn A G 18: 46,850,678 T163A probably benign Het
Met T A 6: 17,491,287 L16* probably null Het
Mpzl2 G T 9: 45,047,289 D108Y probably benign Het
Mrgprb2 T A 7: 48,552,837 I47F probably benign Het
Muc5ac G C 7: 141,809,687 probably benign Het
Mybphl T A 3: 108,374,838 V128E probably damaging Het
Nckap5 A T 1: 126,102,661 D231E probably damaging Het
Olfr1000 T A 2: 85,608,329 M194L probably benign Het
Orm1 T A 4: 63,345,211 I87K probably benign Het
Pdgfrb C T 18: 61,081,004 P954S probably benign Het
Pdzd8 G T 19: 59,345,352 S79* probably null Het
Pdzd9 T A 7: 120,663,002 H79L probably benign Het
Plcg1 A T 2: 160,758,097 I926F probably damaging Het
Plec A T 15: 76,173,541 F4078L probably damaging Het
Plek G A 11: 17,052,220 probably benign Het
Pogz T C 3: 94,854,024 I25T probably damaging Het
Ppfia3 A T 7: 45,358,800 D215E probably benign Het
Psg22 C A 7: 18,724,441 S352R probably benign Het
Ptchd4 A G 17: 42,502,735 Y509C probably damaging Het
Ralgapb C A 2: 158,448,337 N389K probably benign Het
Rdh1 A G 10: 127,763,037 D129G probably benign Het
Rimbp3 A G 16: 17,209,746 T345A probably benign Het
S100a14 T C 3: 90,527,295 probably null Het
Scamp1 T A 13: 94,224,915 R152S probably damaging Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Srf T C 17: 46,550,904 T383A probably benign Het
St6galnac5 T C 3: 152,846,403 M176V probably damaging Het
St8sia1 C A 6: 142,867,906 V177F probably damaging Het
Syt12 C T 19: 4,460,867 probably null Het
Tanc2 A G 11: 105,923,108 I1793V probably benign Het
Tas2r123 A G 6: 132,847,550 I137V probably benign Het
Tenm2 T A 11: 36,171,409 Y543F probably damaging Het
Tgfbr1 T C 4: 47,410,728 I488T probably damaging Het
Tgm1 T A 14: 55,704,941 Y651F possibly damaging Het
Thbs3 A T 3: 89,224,415 D698V probably damaging Het
Tpra1 T A 6: 88,908,312 I82N probably damaging Het
Ubr4 T A 4: 139,393,090 D275E probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wwp1 T C 4: 19,623,124 Y787C probably damaging Het
Znfx1 T C 2: 167,048,534 S677G probably damaging Het
Other mutations in Fbxo40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01339:Fbxo40 APN 16 36970454 missense probably damaging 1.00
IGL02238:Fbxo40 APN 16 36969174 missense possibly damaging 0.63
IGL02389:Fbxo40 APN 16 36969774 missense probably benign 0.26
IGL02619:Fbxo40 APN 16 36970404 missense possibly damaging 0.92
IGL02620:Fbxo40 APN 16 36966080 missense probably benign 0.14
R0532:Fbxo40 UTSW 16 36969622 missense possibly damaging 0.92
R1016:Fbxo40 UTSW 16 36969177 nonsense probably null
R1783:Fbxo40 UTSW 16 36966222 missense probably damaging 0.99
R1832:Fbxo40 UTSW 16 36968856 nonsense probably null
R1938:Fbxo40 UTSW 16 36969351 missense probably damaging 0.98
R1974:Fbxo40 UTSW 16 36969941 missense probably benign
R1995:Fbxo40 UTSW 16 36969869 missense probably damaging 1.00
R3856:Fbxo40 UTSW 16 36969083 missense probably damaging 1.00
R4346:Fbxo40 UTSW 16 36970163 missense probably benign 0.01
R4907:Fbxo40 UTSW 16 36969702 missense probably benign 0.01
R5059:Fbxo40 UTSW 16 36970296 missense possibly damaging 0.48
R5114:Fbxo40 UTSW 16 36968874 missense probably damaging 1.00
R5361:Fbxo40 UTSW 16 36969552 missense possibly damaging 0.62
R5721:Fbxo40 UTSW 16 36968934 missense probably benign 0.06
R5724:Fbxo40 UTSW 16 36970330 missense probably benign 0.18
R5808:Fbxo40 UTSW 16 36970382 missense probably damaging 1.00
R6189:Fbxo40 UTSW 16 36966164 missense probably benign 0.32
R6461:Fbxo40 UTSW 16 36970028 missense probably benign 0.00
R6571:Fbxo40 UTSW 16 36969306 missense probably damaging 1.00
R6598:Fbxo40 UTSW 16 36969014 missense probably damaging 1.00
R6639:Fbxo40 UTSW 16 36970575 missense probably damaging 1.00
X0022:Fbxo40 UTSW 16 36969301 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AACAAGAATTTGGTGCTAGCCTG -3'
(R):5'- AGAGCATACACTCCTCTGCC -3'

Sequencing Primer
(F):5'- AATTTGGTGCTAGCCTGGCATC -3'
(R):5'- GCCTCAACTCTGAGTATGGCTG -3'
Posted On2019-05-13