Mutagenetix > Incidental Mutation

Incidental Mutation 'R7017:Vmn2r111'

545414

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r111

Ensembl Gene

ENSMUSG00000095093

Gene Name

vomeronasal 2, receptor 111

Synonyms

EG210876

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R7017 (G1)

Quality Score

221.999

Status

Validated

Chromosome

Chromosomal Location

22547941-22573273 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 22559051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 549 (N549S)

Ref Sequence

ENSEMBL: ENSMUSP00000090148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000092491]

AlphaFold

K7N674

Predicted Effect

possibly damaging
Transcript: ENSMUST00000092491
AA Change: N549S

PolyPhen 2 Score 0.502 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000090148
Gene: ENSMUSG00000095093
AA Change: N549S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	73	469	2.5e-29	PFAM
Pfam:NCD3G	512	565	1.1e-20	PFAM
Pfam:7tm_3	595	833	5.6e-54	PFAM

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.5%

Validation Efficiency

100% (75/75)

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410137M14Rik	A	G	17: 36,978,034		probably benign	Het
Acot3	A	T	12: 84,053,303		probably benign	Het
Add3	T	A	19: 53,233,853	V297E	possibly damaging	Het
Arfgap1	C	G	2: 180,976,304		probably null	Het
C530008M17Rik	GAGGCAGCGCGAGGCCGAGAGGCAGGAGGAGGAAGCAAGACAACGCGAGGCCGAGAGGCAGG	GAGACAACGCGAGGCCGAGAGGCAGG	5: 76,856,948		probably benign	Het
Cacna1i	T	C	15: 80,380,470	F1500L	probably damaging	Het
Cacna1s	T	C	1: 136,095,858	I945T	probably damaging	Het
Ccdc180	T	A	4: 45,940,934	N1334K	possibly damaging	Het
Cd5l	C	A	3: 87,366,061	Y112*	probably null	Het
Cyp2d40	A	T	15: 82,760,033	F297Y	unknown	Het
Ddx4	C	T	13: 112,601,488	V546I	probably damaging	Het
Dgkg	T	C	16: 22,572,713	M332V	probably benign	Het
Dnah12	T	C	14: 26,735,680	I867T	probably benign	Het
Dnah2	T	A	11: 69,491,547	K1246*	probably null	Het
Drd2	G	A	9: 49,400,829	V161I	probably benign	Het
Dsp	A	G	13: 38,186,707	D862G	probably benign	Het
Ephx4	T	C	5: 107,406,114	F10S	probably damaging	Het
Fabp9	C	A	3: 10,194,696	A76S	possibly damaging	Het
Fam198a	T	C	9: 121,965,986		probably null	Het
Fam46b	T	C	4: 133,486,234	S139P	possibly damaging	Het
Fat4	G	A	3: 38,891,543	M1528I	probably benign	Het
Fbxl12	A	G	9: 20,618,320	S84P	unknown	Het
Fbxo40	T	C	16: 36,970,370	D126G	probably damaging	Het
Fpr1	C	T	17: 17,877,392	V112I	probably benign	Het
Frem2	T	C	3: 53,519,602	N2975S	probably benign	Het
Gm7945	T	C	14: 41,383,653	Y156C		Het
Gnpat	T	C	8: 124,863,275	V13A	probably benign	Het
Gpx5	G	A	13: 21,291,391	P55L	probably damaging	Het
Hbp1	A	G	12: 31,943,853	S59P	probably damaging	Het
Ighv1-36	T	A	12: 114,879,913	D109V	probably damaging	Het
Iqcf5	T	A	9: 106,515,664	I40N	possibly damaging	Het
Kcnma1	T	G	14: 23,494,643	I484L	possibly damaging	Het
Kera	A	T	10: 97,609,077	R99S	possibly damaging	Het
Kif3b	T	A	2: 153,329,724	S707R	possibly damaging	Het
Lilra6	G	T	7: 3,908,708	T317N	possibly damaging	Het
Lrrc15	C	T	16: 30,272,962	E520K	probably benign	Het
Lrrc34	C	T	3: 30,645,316		probably null	Het
Lvrn	A	G	18: 46,850,678	T163A	probably benign	Het
Met	T	A	6: 17,491,287	L16*	probably null	Het
Mpzl2	G	T	9: 45,047,289	D108Y	probably benign	Het
Mrgprb2	T	A	7: 48,552,837	I47F	probably benign	Het
Muc5ac	G	C	7: 141,809,687		probably benign	Het
Mybphl	T	A	3: 108,374,838	V128E	probably damaging	Het
Nckap5	A	T	1: 126,102,661	D231E	probably damaging	Het
Olfr1000	T	A	2: 85,608,329	M194L	probably benign	Het
Orm1	T	A	4: 63,345,211	I87K	probably benign	Het
Pdgfrb	C	T	18: 61,081,004	P954S	probably benign	Het
Pdzd8	G	T	19: 59,345,352	S79*	probably null	Het
Pdzd9	T	A	7: 120,663,002	H79L	probably benign	Het
Plcg1	A	T	2: 160,758,097	I926F	probably damaging	Het
Plec	A	T	15: 76,173,541	F4078L	probably damaging	Het
Plek	G	A	11: 17,052,220		probably benign	Het
Pogz	T	C	3: 94,854,024	I25T	probably damaging	Het
Ppfia3	A	T	7: 45,358,800	D215E	probably benign	Het
Psg22	C	A	7: 18,724,441	S352R	probably benign	Het
Ptchd4	A	G	17: 42,502,735	Y509C	probably damaging	Het
Ralgapb	C	A	2: 158,448,337	N389K	probably benign	Het
Rdh1	A	G	10: 127,763,037	D129G	probably benign	Het
Rimbp3	A	G	16: 17,209,746	T345A	probably benign	Het
S100a14	T	C	3: 90,527,295		probably null	Het
Scamp1	T	A	13: 94,224,915	R152S	probably damaging	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Srf	T	C	17: 46,550,904	T383A	probably benign	Het
St6galnac5	T	C	3: 152,846,403	M176V	probably damaging	Het
St8sia1	C	A	6: 142,867,906	V177F	probably damaging	Het
Syt12	C	T	19: 4,460,867		probably null	Het
Tanc2	A	G	11: 105,923,108	I1793V	probably benign	Het
Tas2r123	A	G	6: 132,847,550	I137V	probably benign	Het
Tenm2	T	A	11: 36,171,409	Y543F	probably damaging	Het
Tgfbr1	T	C	4: 47,410,728	I488T	probably damaging	Het
Tgm1	T	A	14: 55,704,941	Y651F	possibly damaging	Het
Thbs3	A	T	3: 89,224,415	D698V	probably damaging	Het
Tpra1	T	A	6: 88,908,312	I82N	probably damaging	Het
Ubr4	T	A	4: 139,393,090	D275E	probably damaging	Het
Wwp1	T	C	4: 19,623,124	Y787C	probably damaging	Het
Znfx1	T	C	2: 167,048,534	S677G	probably damaging	Het

Other mutations in Vmn2r111

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00932:Vmn2r111	APN	17	22548753	missense	probably benign	0.00
IGL01306:Vmn2r111	APN	17	22568984	missense	probably damaging	0.99
IGL01309:Vmn2r111	APN	17	22569016	missense	possibly damaging	0.51
IGL01457:Vmn2r111	APN	17	22571985	nonsense	probably null
IGL01465:Vmn2r111	APN	17	22548737	missense	probably benign	0.00
IGL01505:Vmn2r111	APN	17	22548572	missense	probably benign	0.00
IGL01571:Vmn2r111	APN	17	22571392	missense	probably damaging	0.99
IGL01715:Vmn2r111	APN	17	22569073	splice site	probably benign
IGL01962:Vmn2r111	APN	17	22548284	missense	possibly damaging	0.90
IGL02190:Vmn2r111	APN	17	22570773	missense	probably benign	0.00
IGL02496:Vmn2r111	APN	17	22568856	missense	probably benign
IGL02519:Vmn2r111	APN	17	22548339	missense	possibly damaging	0.80
IGL02616:Vmn2r111	APN	17	22571050	missense	possibly damaging	0.67
IGL02641:Vmn2r111	APN	17	22573224	missense	possibly damaging	0.82
IGL02690:Vmn2r111	APN	17	22559042	critical splice donor site	probably null
IGL02698:Vmn2r111	APN	17	22571245	missense	probably damaging	1.00
IGL03017:Vmn2r111	APN	17	22570858	missense	probably damaging	1.00
R0046:Vmn2r111	UTSW	17	22548009	missense	probably benign
R0064:Vmn2r111	UTSW	17	22572072	missense	probably benign	0.00
R0519:Vmn2r111	UTSW	17	22573121	missense	probably benign	0.02
R1439:Vmn2r111	UTSW	17	22571116	missense	probably benign	0.00
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1467:Vmn2r111	UTSW	17	22571047	missense	probably damaging	0.99
R1636:Vmn2r111	UTSW	17	22571399	missense	probably damaging	1.00
R1647:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1648:Vmn2r111	UTSW	17	22569061	missense	probably benign	0.03
R1697:Vmn2r111	UTSW	17	22548060	missense	probably benign	0.26
R1996:Vmn2r111	UTSW	17	22548081	missense	probably benign	0.21
R2040:Vmn2r111	UTSW	17	22548414	missense	probably damaging	1.00
R2075:Vmn2r111	UTSW	17	22559062	missense	probably damaging	1.00
R2134:Vmn2r111	UTSW	17	22573104	missense	possibly damaging	0.68
R2357:Vmn2r111	UTSW	17	22559170	splice site	probably benign
R3700:Vmn2r111	UTSW	17	22571161	nonsense	probably null
R3782:Vmn2r111	UTSW	17	22571320	missense	possibly damaging	0.89
R4085:Vmn2r111	UTSW	17	22559115	missense	probably benign	0.00
R4323:Vmn2r111	UTSW	17	22573178	missense	probably benign	0.02
R4900:Vmn2r111	UTSW	17	22548656	missense	possibly damaging	0.94
R5072:Vmn2r111	UTSW	17	22548041	missense	probably damaging	0.99
R5123:Vmn2r111	UTSW	17	22571143	missense	possibly damaging	0.82
R5181:Vmn2r111	UTSW	17	22571020	missense	possibly damaging	0.56
R5357:Vmn2r111	UTSW	17	22548102	nonsense	probably null
R5398:Vmn2r111	UTSW	17	22573271	start codon destroyed	probably null	0.88
R5434:Vmn2r111	UTSW	17	22548489	missense	probably damaging	0.99
R5462:Vmn2r111	UTSW	17	22548257	missense	probably damaging	1.00
R6149:Vmn2r111	UTSW	17	22548815	missense	probably benign	0.00
R6149:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6207:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6281:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6282:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6283:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6307:Vmn2r111	UTSW	17	22573089	missense	probably benign	0.00
R6323:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6325:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6367:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6368:Vmn2r111	UTSW	17	22571908	missense	probably benign	0.38
R6369:Vmn2r111	UTSW	17	22548602	missense	probably damaging	1.00
R6489:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6490:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6546:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6547:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6557:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6654:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6655:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6657:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6659:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6660:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6664:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6798:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6799:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6801:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6893:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6895:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6897:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6922:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6923:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6944:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R6945:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7018:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7024:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7031:Vmn2r111	UTSW	17	22571245	missense	probably damaging	1.00
R7039:Vmn2r111	UTSW	17	22548184	missense	probably damaging	1.00
R7053:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7054:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7055:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7056:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7145:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7146:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7246:Vmn2r111	UTSW	17	22548714	missense	probably damaging	1.00
R7259:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7260:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7327:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7401:Vmn2r111	UTSW	17	22571086	missense	possibly damaging	0.93
R7514:Vmn2r111	UTSW	17	22548399	missense	probably benign	0.05
R7651:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7781:Vmn2r111	UTSW	17	22570733	missense	probably benign	0.17
R7816:Vmn2r111	UTSW	17	22573102	missense	probably damaging	0.97
R7821:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R7838:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8078:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8080:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8117:Vmn2r111	UTSW	17	22571488	missense	probably benign	0.12
R8171:Vmn2r111	UTSW	17	22573092	missense	probably benign	0.10
R8195:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8197:Vmn2r111	UTSW	17	22559051	missense	possibly damaging	0.50
R8411:Vmn2r111	UTSW	17	22548581	missense	probably benign	0.03
R8539:Vmn2r111	UTSW	17	22571293	missense	probably benign	0.23
R8540:Vmn2r111	UTSW	17	22559042	critical splice donor site	probably null
R8540:Vmn2r111	UTSW	17	22559043	missense	probably damaging	1.00
R8557:Vmn2r111	UTSW	17	22571929	nonsense	probably null
R8720:Vmn2r111	UTSW	17	22573213	missense	possibly damaging	0.88
R8729:Vmn2r111	UTSW	17	22548258	missense	probably damaging	1.00
R8843:Vmn2r111	UTSW	17	22548030	missense	probably benign	0.00
R9184:Vmn2r111	UTSW	17	22571841	missense	probably benign
R9374:Vmn2r111	UTSW	17	22568878	missense	probably benign	0.17
R9452:Vmn2r111	UTSW	17	22559151	missense	probably damaging	1.00
X0026:Vmn2r111	UTSW	17	22548695	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- GTGTAAAAGATGCAGCCCAATTTC -3'
(R):5'- TACAGGATGCTATCAGGTTTTCTTC -3'

Sequencing Primer
(F):5'- GAGTAACTTAGGACAGAGATGt -3'
(R):5'- TTCAAGGAGTTGGGAAACAATTC -3'

Posted On

2019-05-13