Mutagenetix > Incidental Mutation

Incidental Mutation 'R7018:Lamc2'

545427

Institutional Source

Beutler Lab

Gene Symbol

Lamc2

Ensembl Gene

ENSMUSG00000026479

Gene Name

laminin, gamma 2

Synonyms

nicein, 100kDa

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.530) question?

Stock #

R7018 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

153122756-153186447 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 153136742 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 729 (M729L)

Ref Sequence

ENSEMBL: ENSMUSP00000140514 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000027753
AA Change: M729L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: M729L

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000185356
AA Change: M729L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: M729L

Domain	Start	End	E-Value	Type
EGF_Lam	28	81	1.03e-7	SMART
EGF_Lam	84	128	2.14e-14	SMART
EGF_Lam	139	184	4.52e-13	SMART
LamB	245	370	7.58e-46	SMART
EGF_like	370	413	3.83e0	SMART
Blast:EGF_like	417	460	8e-23	BLAST
EGF_Lam	462	514	1.95e-8	SMART
EGF_Lam	517	570	1.88e-10	SMART
EGF_like	573	610	2.6e-1	SMART
coiled coil region	612	680	N/A	INTRINSIC
low complexity region	792	817	N/A	INTRINSIC
coiled coil region	952	994	N/A	INTRINSIC
low complexity region	1016	1027	N/A	INTRINSIC
coiled coil region	1039	1072	N/A	INTRINSIC

Meta Mutation Damage Score

0.0646

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apcdd1	G	T	18: 62,937,049	R129L	probably damaging	Het
Arhgef28	C	T	13: 97,965,435	V844I	probably damaging	Het
Arhgef5	T	C	6: 43,288,731	V1569A	probably damaging	Het
Atr	T	A	9: 95,866,694	S431T	probably benign	Het
Cdh11	T	C	8: 102,634,321	D795G	possibly damaging	Het
Crygf	T	C	1: 65,927,971	S85P	probably benign	Het
Diexf	A	G	1: 193,114,855	I563T	probably benign	Het
Dip2c	T	A	13: 9,659,278	Y1385N	probably damaging	Het
Dnah14	G	A	1: 181,626,944	V840I	possibly damaging	Het
Dsg1a	T	C	18: 20,328,738	F299L	possibly damaging	Het
Fgfr4	A	T	13: 55,166,200	S576C	probably damaging	Het
Frmd8	T	C	19: 5,869,518	D167G	probably damaging	Het
Gm5105	G	A	3: 138,049,558	T89I	unknown	Het
Grhl1	C	T	12: 24,575,997	S35L	possibly damaging	Het
Gsn	A	G	2: 35,293,506	E242G	probably benign	Het
Hcrtr1	A	G	4: 130,135,868	I140T	probably damaging	Het
Ifnlr1	T	C	4: 135,703,824	Y208H	possibly damaging	Het
Ighv1-58	T	C	12: 115,312,365	Y51C	probably damaging	Het
Iqcj	T	A	3: 68,041,247	Y21*	probably null	Het
Kcnc4	T	C	3: 107,458,862	Y10C	probably benign	Het
Kcnk7	G	T	19: 5,706,132	G129W	probably damaging	Het
Kcnq2	T	A	2: 181,081,724	R620*	probably null	Het
Klk13	C	A	7: 43,726,702	P267Q	probably benign	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
L3mbtl4	G	A	17: 68,486,943	R314H	probably damaging	Het
Lyst	T	G	13: 13,743,459		probably null	Het
Med13l	G	A	5: 118,751,986	R1909H	probably damaging	Het
Mstn	T	A	1: 53,064,084	L193Q	possibly damaging	Het
Mylk	T	C	16: 35,000,426	V125A	possibly damaging	Het
Nalcn	T	A	14: 123,409,821	M547L	probably damaging	Het
Nckap5	A	G	1: 126,025,048	S1256P	probably damaging	Het
Nkain1	T	C	4: 130,532,118	Y189C	probably damaging	Het
Olfr1164	T	A	2: 88,093,256	I227F	probably benign	Het
Olfr193	A	G	16: 59,110,607	M1T	probably null	Het
Olfr490	T	G	7: 108,286,344	I261L	probably benign	Het
Olfr761	A	T	17: 37,952,502	I174N	probably damaging	Het
Oosp3	T	A	19: 11,699,419	D47E	probably benign	Het
Pcdh15	G	T	10: 74,466,354	G942W	probably damaging	Het
Pcyox1l	C	A	18: 61,707,554		probably benign	Het
Peg3	T	C	7: 6,708,839	E1128G	possibly damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plscr1	T	A	9: 92,264,662	V119D	probably damaging	Het
Prss56	A	T	1: 87,185,948	D258V	possibly damaging	Het
Ptpn23	T	G	9: 110,385,816	K85Q	possibly damaging	Het
Ranbp3l	C	A	15: 9,007,285	S7Y	probably benign	Het
Rnf31	T	C	14: 55,592,233	L85P	probably damaging	Het
Rptn	T	C	3: 93,397,900	C847R	possibly damaging	Het
Six4	T	A	12: 73,108,953	E413D	probably benign	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Sned1	T	C	1: 93,284,421	V1115A	probably damaging	Het
Spen	T	C	4: 141,493,444	K401E	unknown	Het
Srbd1	T	A	17: 86,136,415	R128W	possibly damaging	Het
Strc	A	T	2: 121,369,058	I1300N	probably damaging	Het
Susd1	T	G	4: 59,390,627	T230P	probably benign	Het
Thumpd2	G	T	17: 81,055,897	S47*	probably null	Het
Tmprss11a	C	T	5: 86,428,570	V141I	probably damaging	Het
Tmprss15	T	C	16: 79,024,853	Y438C	possibly damaging	Het
Tnfrsf1a	T	C	6: 125,356,951	S56P	probably damaging	Het
Ttc39d	T	C	17: 80,216,181	W90R	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20rt	A	T	12: 65,225,762		probably null	Het
Zfp646	C	A	7: 127,882,322	Q1224K	probably benign	Het

Other mutations in Lamc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00771:Lamc2	APN	1	153130056	missense	probably benign	0.00
IGL00907:Lamc2	APN	1	153144651	missense	probably benign	0.32
IGL02026:Lamc2	APN	1	153144736	splice site	probably benign
IGL02335:Lamc2	APN	1	153166216	missense	probably benign	0.00
IGL02568:Lamc2	APN	1	153166262	missense	possibly damaging	0.91
IGL02640:Lamc2	APN	1	153152057	missense	probably damaging	0.99
IGL02801:Lamc2	APN	1	153136783	missense	probably benign	0.10
IGL02827:Lamc2	APN	1	153139781	missense	probably damaging	1.00
IGL03240:Lamc2	APN	1	153124125	missense	probably damaging	1.00
IGL03245:Lamc2	APN	1	153133757	splice site	probably null
abasement	UTSW	1	153127025	missense	probably null	0.86
ANU74:Lamc2	UTSW	1	153131835	missense	probably benign	0.00
R0279:Lamc2	UTSW	1	153130696	missense	probably benign	0.01
R0528:Lamc2	UTSW	1	153124094	missense	probably damaging	1.00
R0597:Lamc2	UTSW	1	153133621	missense	probably benign	0.02
R0650:Lamc2	UTSW	1	153143876	missense	possibly damaging	0.88
R0826:Lamc2	UTSW	1	153152082	missense	probably damaging	1.00
R1015:Lamc2	UTSW	1	153166199	missense	possibly damaging	0.53
R1172:Lamc2	UTSW	1	153166287	missense	probably damaging	1.00
R1308:Lamc2	UTSW	1	153150818	missense	probably damaging	1.00
R1521:Lamc2	UTSW	1	153166263	missense	probably benign	0.11
R1525:Lamc2	UTSW	1	153130756	missense	probably benign	0.00
R1602:Lamc2	UTSW	1	153127028	missense	probably benign	0.00
R1631:Lamc2	UTSW	1	153158934	missense	possibly damaging	0.95
R1633:Lamc2	UTSW	1	153141698	nonsense	probably null
R1832:Lamc2	UTSW	1	153166187	missense	possibly damaging	0.72
R1978:Lamc2	UTSW	1	153133597	critical splice donor site	probably null
R1996:Lamc2	UTSW	1	153154470	missense	possibly damaging	0.84
R2046:Lamc2	UTSW	1	153141765	missense	probably benign	0.01
R2107:Lamc2	UTSW	1	153154386	splice site	probably benign
R2130:Lamc2	UTSW	1	153127124	missense	probably damaging	1.00
R2182:Lamc2	UTSW	1	153126866	missense	possibly damaging	0.46
R2207:Lamc2	UTSW	1	153133706	missense	possibly damaging	0.68
R2218:Lamc2	UTSW	1	153130779	missense	probably benign	0.21
R3772:Lamc2	UTSW	1	153124251	missense	probably benign
R4616:Lamc2	UTSW	1	153166169	missense	probably damaging	1.00
R4874:Lamc2	UTSW	1	153154395	missense	probably null	1.00
R4939:Lamc2	UTSW	1	153126836	missense	probably damaging	1.00
R4985:Lamc2	UTSW	1	153136805	missense	probably benign
R5544:Lamc2	UTSW	1	153124053	missense	possibly damaging	0.93
R5632:Lamc2	UTSW	1	153131890	missense	probably damaging	1.00
R5771:Lamc2	UTSW	1	153141594	missense	probably benign	0.04
R5811:Lamc2	UTSW	1	153166253	missense	possibly damaging	0.53
R6058:Lamc2	UTSW	1	153136829	missense	probably benign	0.01
R6130:Lamc2	UTSW	1	153136777	missense	probably benign	0.01
R6137:Lamc2	UTSW	1	153166153	missense	possibly damaging	0.90
R6994:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6995:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R6997:Lamc2	UTSW	1	153136762	missense	probably benign	0.18
R7000:Lamc2	UTSW	1	153166127	missense	possibly damaging	0.72
R7145:Lamc2	UTSW	1	153130772	missense	possibly damaging	0.95
R7148:Lamc2	UTSW	1	153185984	missense	probably benign	0.01
R7171:Lamc2	UTSW	1	153139749	missense	probably damaging	1.00
R7640:Lamc2	UTSW	1	153136804	missense	possibly damaging	0.79
R7673:Lamc2	UTSW	1	153124036	missense	probably damaging	1.00
R7684:Lamc2	UTSW	1	153127025	missense	probably null	0.86
R7712:Lamc2	UTSW	1	153133611	missense	possibly damaging	0.81
R7940:Lamc2	UTSW	1	153130775	nonsense	probably null
R8153:Lamc2	UTSW	1	153124104	frame shift	probably null
R8211:Lamc2	UTSW	1	153166278	missense	probably damaging	1.00
R8486:Lamc2	UTSW	1	153158891	missense	probably benign
R8739:Lamc2	UTSW	1	153144653	nonsense	probably null
R8744:Lamc2	UTSW	1	153143738	missense	probably benign	0.19
R8911:Lamc2	UTSW	1	153152127	missense	probably damaging	1.00
R9435:Lamc2	UTSW	1	153137326	missense	probably benign	0.00
R9457:Lamc2	UTSW	1	153139854	missense	probably benign
RF024:Lamc2	UTSW	1	153152055	missense	possibly damaging	0.70
Z1176:Lamc2	UTSW	1	153133621	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CATAGACAGGCCTGTGACAAAG -3'
(R):5'- CGGTCATTCTGCATCAGTCTG -3'

Sequencing Primer
(F):5'- GAAGAAAAGCCCAGCTACCTG -3'
(R):5'- GTCATTCTGCATCAGTCTGGTTTTTC -3'

Posted On

2019-05-13