Incidental Mutation 'R7018:Lamc2'
ID 545427
Institutional Source Beutler Lab
Gene Symbol Lamc2
Ensembl Gene ENSMUSG00000026479
Gene Name laminin, gamma 2
Synonyms nicein, 100kDa
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.485) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 152998502-153062193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 153012488 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 729 (M729L)
Ref Sequence ENSEMBL: ENSMUSP00000140514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027753] [ENSMUST00000185356]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000027753
AA Change: M729L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000027753
Gene: ENSMUSG00000026479
AA Change: M729L

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185356
AA Change: M729L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140514
Gene: ENSMUSG00000026479
AA Change: M729L

DomainStartEndE-ValueType
EGF_Lam 28 81 1.03e-7 SMART
EGF_Lam 84 128 2.14e-14 SMART
EGF_Lam 139 184 4.52e-13 SMART
LamB 245 370 7.58e-46 SMART
EGF_like 370 413 3.83e0 SMART
Blast:EGF_like 417 460 8e-23 BLAST
EGF_Lam 462 514 1.95e-8 SMART
EGF_Lam 517 570 1.88e-10 SMART
EGF_like 573 610 2.6e-1 SMART
coiled coil region 612 680 N/A INTRINSIC
low complexity region 792 817 N/A INTRINSIC
coiled coil region 952 994 N/A INTRINSIC
low complexity region 1016 1027 N/A INTRINSIC
coiled coil region 1039 1072 N/A INTRINSIC
Meta Mutation Damage Score 0.0646 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins, composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively), have a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 2. The gamma 2 chain, formerly thought to be a truncated version of beta chain (B2t), is highly homologous to the gamma 1 chain; however, it lacks domain VI, and domains V, IV and III are shorter. It is expressed in several fetal tissues but differently from gamma 1, and is specifically localized to epithelial cells in skin, lung and kidney. The gamma 2 chain together with alpha 3 and beta 3 chains constitute laminin 5 (earlier known as kalinin), which is an integral part of the anchoring filaments that connect epithelial cells to the underlying basement membrane. The epithelium-specific expression of the gamma 2 chain implied its role as an epithelium attachment molecule, and mutations in this gene have been associated with junctional epidermolysis bullosa, a skin disease characterized by blisters due to disruption of the epidermal-dermal junction. Two transcript variants resulting from alternative splicing of the 3' terminal exon, and encoding different isoforms of gamma 2 chain, have been described. The two variants are differentially expressed in embryonic tissues, however, the biological significance of the two forms is not known. Transcript variants utilizing alternative polyA_signal have also been noted in literature. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in cell:cell adhesion involving epithelial cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Lamc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00771:Lamc2 APN 1 153,005,802 (GRCm39) missense probably benign 0.00
IGL00907:Lamc2 APN 1 153,020,397 (GRCm39) missense probably benign 0.32
IGL02026:Lamc2 APN 1 153,020,482 (GRCm39) splice site probably benign
IGL02335:Lamc2 APN 1 153,041,962 (GRCm39) missense probably benign 0.00
IGL02568:Lamc2 APN 1 153,042,008 (GRCm39) missense possibly damaging 0.91
IGL02640:Lamc2 APN 1 153,027,803 (GRCm39) missense probably damaging 0.99
IGL02801:Lamc2 APN 1 153,012,529 (GRCm39) missense probably benign 0.10
IGL02827:Lamc2 APN 1 153,015,527 (GRCm39) missense probably damaging 1.00
IGL03240:Lamc2 APN 1 152,999,871 (GRCm39) missense probably damaging 1.00
IGL03245:Lamc2 APN 1 153,009,503 (GRCm39) splice site probably null
abasement UTSW 1 153,002,771 (GRCm39) missense probably null 0.86
ANU74:Lamc2 UTSW 1 153,007,581 (GRCm39) missense probably benign 0.00
R0279:Lamc2 UTSW 1 153,006,442 (GRCm39) missense probably benign 0.01
R0528:Lamc2 UTSW 1 152,999,840 (GRCm39) missense probably damaging 1.00
R0597:Lamc2 UTSW 1 153,009,367 (GRCm39) missense probably benign 0.02
R0650:Lamc2 UTSW 1 153,019,622 (GRCm39) missense possibly damaging 0.88
R0826:Lamc2 UTSW 1 153,027,828 (GRCm39) missense probably damaging 1.00
R1015:Lamc2 UTSW 1 153,041,945 (GRCm39) missense possibly damaging 0.53
R1172:Lamc2 UTSW 1 153,042,033 (GRCm39) missense probably damaging 1.00
R1308:Lamc2 UTSW 1 153,026,564 (GRCm39) missense probably damaging 1.00
R1521:Lamc2 UTSW 1 153,042,009 (GRCm39) missense probably benign 0.11
R1525:Lamc2 UTSW 1 153,006,502 (GRCm39) missense probably benign 0.00
R1602:Lamc2 UTSW 1 153,002,774 (GRCm39) missense probably benign 0.00
R1631:Lamc2 UTSW 1 153,034,680 (GRCm39) missense possibly damaging 0.95
R1633:Lamc2 UTSW 1 153,017,444 (GRCm39) nonsense probably null
R1832:Lamc2 UTSW 1 153,041,933 (GRCm39) missense possibly damaging 0.72
R1978:Lamc2 UTSW 1 153,009,343 (GRCm39) critical splice donor site probably null
R1996:Lamc2 UTSW 1 153,030,216 (GRCm39) missense possibly damaging 0.84
R2046:Lamc2 UTSW 1 153,017,511 (GRCm39) missense probably benign 0.01
R2107:Lamc2 UTSW 1 153,030,132 (GRCm39) splice site probably benign
R2130:Lamc2 UTSW 1 153,002,870 (GRCm39) missense probably damaging 1.00
R2182:Lamc2 UTSW 1 153,002,612 (GRCm39) missense possibly damaging 0.46
R2207:Lamc2 UTSW 1 153,009,452 (GRCm39) missense possibly damaging 0.68
R2218:Lamc2 UTSW 1 153,006,525 (GRCm39) missense probably benign 0.21
R3772:Lamc2 UTSW 1 152,999,997 (GRCm39) missense probably benign
R4616:Lamc2 UTSW 1 153,041,915 (GRCm39) missense probably damaging 1.00
R4874:Lamc2 UTSW 1 153,030,141 (GRCm39) missense probably null 1.00
R4939:Lamc2 UTSW 1 153,002,582 (GRCm39) missense probably damaging 1.00
R4985:Lamc2 UTSW 1 153,012,551 (GRCm39) missense probably benign
R5544:Lamc2 UTSW 1 152,999,799 (GRCm39) missense possibly damaging 0.93
R5632:Lamc2 UTSW 1 153,007,636 (GRCm39) missense probably damaging 1.00
R5771:Lamc2 UTSW 1 153,017,340 (GRCm39) missense probably benign 0.04
R5811:Lamc2 UTSW 1 153,041,999 (GRCm39) missense possibly damaging 0.53
R6058:Lamc2 UTSW 1 153,012,575 (GRCm39) missense probably benign 0.01
R6130:Lamc2 UTSW 1 153,012,523 (GRCm39) missense probably benign 0.01
R6137:Lamc2 UTSW 1 153,041,899 (GRCm39) missense possibly damaging 0.90
R6994:Lamc2 UTSW 1 153,012,508 (GRCm39) missense probably benign 0.18
R6995:Lamc2 UTSW 1 153,012,508 (GRCm39) missense probably benign 0.18
R6997:Lamc2 UTSW 1 153,012,508 (GRCm39) missense probably benign 0.18
R7000:Lamc2 UTSW 1 153,041,873 (GRCm39) missense possibly damaging 0.72
R7145:Lamc2 UTSW 1 153,006,518 (GRCm39) missense possibly damaging 0.95
R7148:Lamc2 UTSW 1 153,061,730 (GRCm39) missense probably benign 0.01
R7171:Lamc2 UTSW 1 153,015,495 (GRCm39) missense probably damaging 1.00
R7640:Lamc2 UTSW 1 153,012,550 (GRCm39) missense possibly damaging 0.79
R7673:Lamc2 UTSW 1 152,999,782 (GRCm39) missense probably damaging 1.00
R7684:Lamc2 UTSW 1 153,002,771 (GRCm39) missense probably null 0.86
R7712:Lamc2 UTSW 1 153,009,357 (GRCm39) missense possibly damaging 0.81
R7940:Lamc2 UTSW 1 153,006,521 (GRCm39) nonsense probably null
R8153:Lamc2 UTSW 1 152,999,850 (GRCm39) frame shift probably null
R8211:Lamc2 UTSW 1 153,042,024 (GRCm39) missense probably damaging 1.00
R8486:Lamc2 UTSW 1 153,034,637 (GRCm39) missense probably benign
R8739:Lamc2 UTSW 1 153,020,399 (GRCm39) nonsense probably null
R8744:Lamc2 UTSW 1 153,019,484 (GRCm39) missense probably benign 0.19
R8911:Lamc2 UTSW 1 153,027,873 (GRCm39) missense probably damaging 1.00
R9435:Lamc2 UTSW 1 153,013,072 (GRCm39) missense probably benign 0.00
R9457:Lamc2 UTSW 1 153,015,600 (GRCm39) missense probably benign
RF024:Lamc2 UTSW 1 153,027,801 (GRCm39) missense possibly damaging 0.70
Z1176:Lamc2 UTSW 1 153,009,367 (GRCm39) missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CATAGACAGGCCTGTGACAAAG -3'
(R):5'- CGGTCATTCTGCATCAGTCTG -3'

Sequencing Primer
(F):5'- GAAGAAAAGCCCAGCTACCTG -3'
(R):5'- GTCATTCTGCATCAGTCTGGTTTTTC -3'
Posted On 2019-05-13