Incidental Mutation 'R7018:Diexf'
ID545429
Institutional Source Beutler Lab
Gene Symbol Diexf
Ensembl Gene ENSMUSG00000016181
Gene Namedigestive organ expansion factor homolog (zebrafish)
SynonymsAA408296
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R7018 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location193091104-193130272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 193114855 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 563 (I563T)
Ref Sequence ENSEMBL: ENSMUSP00000082691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085555] [ENSMUST00000193460] [ENSMUST00000195291]
Predicted Effect probably benign
Transcript: ENSMUST00000085555
AA Change: I563T

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000082691
Gene: ENSMUSG00000016181
AA Change: I563T

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:UTP25 288 763 6.1e-200 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193460
AA Change: I75T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000142059
Gene: ENSMUSG00000016181
AA Change: I75T

DomainStartEndE-ValueType
Pfam:DUF1253 1 205 6.8e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194412
Predicted Effect probably benign
Transcript: ENSMUST00000195291
AA Change: I563T

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141676
Gene: ENSMUSG00000016181
AA Change: I563T

DomainStartEndE-ValueType
low complexity region 51 70 N/A INTRINSIC
coiled coil region 72 113 N/A INTRINSIC
low complexity region 123 139 N/A INTRINSIC
low complexity region 217 224 N/A INTRINSIC
Pfam:DUF1253 325 634 6.9e-100 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 62,937,049 R129L probably damaging Het
Arhgef28 C T 13: 97,965,435 V844I probably damaging Het
Arhgef5 T C 6: 43,288,731 V1569A probably damaging Het
Atr T A 9: 95,866,694 S431T probably benign Het
Cdh11 T C 8: 102,634,321 D795G possibly damaging Het
Crygf T C 1: 65,927,971 S85P probably benign Het
Dip2c T A 13: 9,659,278 Y1385N probably damaging Het
Dnah14 G A 1: 181,626,944 V840I possibly damaging Het
Dsg1a T C 18: 20,328,738 F299L possibly damaging Het
Fgfr4 A T 13: 55,166,200 S576C probably damaging Het
Frmd8 T C 19: 5,869,518 D167G probably damaging Het
Gm5105 G A 3: 138,049,558 T89I unknown Het
Grhl1 C T 12: 24,575,997 S35L possibly damaging Het
Gsn A G 2: 35,293,506 E242G probably benign Het
Hcrtr1 A G 4: 130,135,868 I140T probably damaging Het
Ifnlr1 T C 4: 135,703,824 Y208H possibly damaging Het
Ighv1-58 T C 12: 115,312,365 Y51C probably damaging Het
Iqcj T A 3: 68,041,247 Y21* probably null Het
Kcnc4 T C 3: 107,458,862 Y10C probably benign Het
Kcnk7 G T 19: 5,706,132 G129W probably damaging Het
Kcnq2 T A 2: 181,081,724 R620* probably null Het
Klk13 C A 7: 43,726,702 P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Lamc2 T A 1: 153,136,742 M729L probably benign Het
Lyst T G 13: 13,743,459 probably null Het
Med13l G A 5: 118,751,986 R1909H probably damaging Het
Mstn T A 1: 53,064,084 L193Q possibly damaging Het
Mylk T C 16: 35,000,426 V125A possibly damaging Het
Nalcn T A 14: 123,409,821 M547L probably damaging Het
Nckap5 A G 1: 126,025,048 S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 Y189C probably damaging Het
Olfr1164 T A 2: 88,093,256 I227F probably benign Het
Olfr193 A G 16: 59,110,607 M1T probably null Het
Olfr490 T G 7: 108,286,344 I261L probably benign Het
Olfr761 A T 17: 37,952,502 I174N probably damaging Het
Oosp3 T A 19: 11,699,419 D47E probably benign Het
Pcdh15 G T 10: 74,466,354 G942W probably damaging Het
Pcyox1l C A 18: 61,707,554 probably benign Het
Peg3 T C 7: 6,708,839 E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plscr1 T A 9: 92,264,662 V119D probably damaging Het
Prss56 A T 1: 87,185,948 D258V possibly damaging Het
Ptpn23 T G 9: 110,385,816 K85Q possibly damaging Het
Ranbp3l C A 15: 9,007,285 S7Y probably benign Het
Rnf31 T C 14: 55,592,233 L85P probably damaging Het
Rptn T C 3: 93,397,900 C847R possibly damaging Het
Six4 T A 12: 73,108,953 E413D probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Sned1 T C 1: 93,284,421 V1115A probably damaging Het
Spen T C 4: 141,493,444 K401E unknown Het
Srbd1 T A 17: 86,136,415 R128W possibly damaging Het
Strc A T 2: 121,369,058 I1300N probably damaging Het
Susd1 T G 4: 59,390,627 T230P probably benign Het
Thumpd2 G T 17: 81,055,897 S47* probably null Het
Tmprss11a C T 5: 86,428,570 V141I probably damaging Het
Tmprss15 T C 16: 79,024,853 Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,356,951 S56P probably damaging Het
Ttc39d T C 17: 80,216,181 W90R probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20rt A T 12: 65,225,762 probably null Het
Zfp646 C A 7: 127,882,322 Q1224K probably benign Het
Other mutations in Diexf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00754:Diexf APN 1 193115001 missense probably damaging 1.00
IGL01700:Diexf APN 1 193118265 missense probably damaging 1.00
IGL02076:Diexf APN 1 193130059 missense probably damaging 1.00
IGL02121:Diexf APN 1 193118278 missense probably benign 0.05
IGL02666:Diexf APN 1 193107596 nonsense probably null
IGL02997:Diexf APN 1 193120584 missense probably benign 0.34
3-1:Diexf UTSW 1 193118280 missense probably benign 0.07
R0099:Diexf UTSW 1 193128470 missense probably damaging 1.00
R0395:Diexf UTSW 1 193123676 missense possibly damaging 0.69
R0502:Diexf UTSW 1 193114828 splice site probably benign
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0973:Diexf UTSW 1 193114703 missense probably damaging 0.98
R0974:Diexf UTSW 1 193114703 missense probably damaging 0.98
R1815:Diexf UTSW 1 193118283 missense probably benign 0.26
R1930:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1931:Diexf UTSW 1 193118309 missense probably damaging 1.00
R1937:Diexf UTSW 1 193122093 missense probably damaging 1.00
R2847:Diexf UTSW 1 193128451 missense probably benign 0.41
R2848:Diexf UTSW 1 193128451 missense probably benign 0.41
R3412:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R3414:Diexf UTSW 1 193128502 missense possibly damaging 0.93
R4471:Diexf UTSW 1 193130137 missense possibly damaging 0.68
R4627:Diexf UTSW 1 193107695 missense probably benign 0.00
R4644:Diexf UTSW 1 193128480 missense probably damaging 1.00
R4761:Diexf UTSW 1 193113922 missense probably damaging 1.00
R4791:Diexf UTSW 1 193128267 missense probably benign
R4793:Diexf UTSW 1 193113808 missense probably null 0.56
R4858:Diexf UTSW 1 193113764 missense probably damaging 1.00
R4944:Diexf UTSW 1 193114954 missense probably damaging 1.00
R5162:Diexf UTSW 1 193113781 missense probably damaging 1.00
R5347:Diexf UTSW 1 193128379 missense probably benign
R5837:Diexf UTSW 1 193118393 missense probably damaging 1.00
R6113:Diexf UTSW 1 193129502 missense probably null 0.01
R6455:Diexf UTSW 1 193128376 missense probably benign 0.07
R6563:Diexf UTSW 1 193118390 missense probably damaging 1.00
R6636:Diexf UTSW 1 193113767 missense probably damaging 1.00
R7037:Diexf UTSW 1 193120723 splice site probably null
R8027:Diexf UTSW 1 193118222 missense probably benign
R8042:Diexf UTSW 1 193114672 missense
RF021:Diexf UTSW 1 193120666 missense probably benign
X0050:Diexf UTSW 1 193123732 missense probably benign 0.23
Z1177:Diexf UTSW 1 193114675 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCACCAACACATGACTGATG -3'
(R):5'- GGGTGCTCTGCAGTCACTAATG -3'

Sequencing Primer
(F):5'- ATGACTGATGGAGCCCGTCATG -3'
(R):5'- GCTGGTATTTTGCACCAAGC -3'
Posted On2019-05-13