Incidental Mutation 'R7018:Gsn'
ID 545430
Institutional Source Beutler Lab
Gene Symbol Gsn
Ensembl Gene ENSMUSG00000026879
Gene Name gelsolin
Synonyms
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.558) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 35146392-35197904 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 35183518 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 242 (E242G)
Ref Sequence ENSEMBL: ENSMUSP00000144296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028239] [ENSMUST00000139867] [ENSMUST00000142324] [ENSMUST00000201185] [ENSMUST00000202899] [ENSMUST00000202990]
AlphaFold P13020
Predicted Effect probably benign
Transcript: ENSMUST00000028239
AA Change: E280G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000028239
Gene: ENSMUSG00000026879
AA Change: E280G

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
GEL 64 162 7.31e-30 SMART
GEL 183 275 1.53e-32 SMART
GEL 299 394 2.59e-30 SMART
GEL 443 540 9.28e-32 SMART
GEL 561 646 1.67e-24 SMART
GEL 666 761 4.04e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139867
SMART Domains Protein: ENSMUSP00000144217
Gene: ENSMUSG00000026879

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142324
AA Change: E231G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118120
Gene: ENSMUSG00000026879
AA Change: E231G

DomainStartEndE-ValueType
GEL 15 113 7.31e-30 SMART
GEL 134 226 1.53e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000201185
AA Change: E231G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144561
Gene: ENSMUSG00000026879
AA Change: E231G

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
GEL 250 345 1.6e-32 SMART
GEL 394 491 5.8e-34 SMART
GEL 512 597 1.1e-26 SMART
GEL 617 712 2.7e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202899
AA Change: E231G

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000144470
Gene: ENSMUSG00000026879
AA Change: E231G

DomainStartEndE-ValueType
GEL 15 113 4.9e-32 SMART
GEL 134 226 9.6e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202990
AA Change: E242G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000144296
Gene: ENSMUSG00000026879
AA Change: E242G

DomainStartEndE-ValueType
GEL 26 124 4.9e-32 SMART
GEL 145 237 9.6e-35 SMART
GEL 261 356 1.6e-32 SMART
GEL 405 502 5.8e-34 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene binds to the "plus" ends of actin monomers and filaments to prevent monomer exchange. The encoded calcium-regulated protein functions in both assembly and disassembly of actin filaments. Defects in this gene are a cause of familial amyloidosis Finnish type (FAF). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in the immune system, platelet and platelet function, bone density, nervous and circulatory system. In addition, there are background related effects on viability and mammary gland development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Gsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00797:Gsn APN 2 35,174,049 (GRCm39) missense probably damaging 1.00
IGL02119:Gsn APN 2 35,192,507 (GRCm39) missense probably damaging 1.00
IGL02512:Gsn APN 2 35,173,962 (GRCm39) nonsense probably null
IGL02550:Gsn APN 2 35,172,619 (GRCm39) intron probably benign
IGL02975:Gsn APN 2 35,194,666 (GRCm39) missense probably benign 0.25
IGL03061:Gsn APN 2 35,172,471 (GRCm39) intron probably benign
R0321:Gsn UTSW 2 35,180,408 (GRCm39) missense probably benign 0.03
R0454:Gsn UTSW 2 35,194,651 (GRCm39) missense probably damaging 1.00
R1446:Gsn UTSW 2 35,196,598 (GRCm39) missense probably benign 0.04
R1760:Gsn UTSW 2 35,174,835 (GRCm39) missense probably damaging 1.00
R1974:Gsn UTSW 2 35,191,483 (GRCm39) missense probably damaging 1.00
R2258:Gsn UTSW 2 35,180,349 (GRCm39) missense probably damaging 1.00
R2260:Gsn UTSW 2 35,180,349 (GRCm39) missense probably damaging 1.00
R2281:Gsn UTSW 2 35,173,930 (GRCm39) missense probably benign 0.01
R2495:Gsn UTSW 2 35,193,205 (GRCm39) missense probably damaging 1.00
R2516:Gsn UTSW 2 35,173,965 (GRCm39) missense probably benign
R3896:Gsn UTSW 2 35,192,650 (GRCm39) missense possibly damaging 0.92
R4003:Gsn UTSW 2 35,173,995 (GRCm39) missense probably benign 0.38
R4006:Gsn UTSW 2 35,197,633 (GRCm39) nonsense probably null
R4281:Gsn UTSW 2 35,188,883 (GRCm39) missense probably damaging 1.00
R4291:Gsn UTSW 2 35,180,432 (GRCm39) missense probably benign 0.14
R4692:Gsn UTSW 2 35,188,883 (GRCm39) missense probably damaging 1.00
R4850:Gsn UTSW 2 35,173,912 (GRCm39) splice site probably null
R4895:Gsn UTSW 2 35,192,590 (GRCm39) missense probably damaging 1.00
R5011:Gsn UTSW 2 35,188,933 (GRCm39) missense probably damaging 1.00
R5013:Gsn UTSW 2 35,188,933 (GRCm39) missense probably damaging 1.00
R5290:Gsn UTSW 2 35,186,484 (GRCm39) missense probably benign 0.01
R6472:Gsn UTSW 2 35,180,463 (GRCm39) splice site probably null
R6764:Gsn UTSW 2 35,174,056 (GRCm39) missense probably damaging 1.00
R7036:Gsn UTSW 2 35,182,611 (GRCm39) missense probably damaging 1.00
R7097:Gsn UTSW 2 35,185,061 (GRCm39) nonsense probably null
R7122:Gsn UTSW 2 35,185,061 (GRCm39) nonsense probably null
R7183:Gsn UTSW 2 35,184,960 (GRCm39) missense probably benign 0.00
R7203:Gsn UTSW 2 35,188,807 (GRCm39) missense probably benign 0.00
R7456:Gsn UTSW 2 35,172,718 (GRCm39) missense possibly damaging 0.84
R7488:Gsn UTSW 2 35,186,433 (GRCm39) missense possibly damaging 0.65
R7880:Gsn UTSW 2 35,173,939 (GRCm39) missense probably damaging 1.00
R8088:Gsn UTSW 2 35,182,659 (GRCm39) missense possibly damaging 0.77
R9472:Gsn UTSW 2 35,182,741 (GRCm39) missense probably damaging 1.00
R9479:Gsn UTSW 2 35,186,227 (GRCm39) critical splice donor site probably null
R9568:Gsn UTSW 2 35,174,003 (GRCm39) missense probably benign 0.02
R9777:Gsn UTSW 2 35,194,600 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGAAAGTCCAGCCTGG -3'
(R):5'- TACGGATGGACTCAGCATCC -3'

Sequencing Primer
(F):5'- ACTTGATGAGAGCTCGTTCTC -3'
(R):5'- GGACTCAGCATCCCCGCTTAC -3'
Posted On 2019-05-13