Incidental Mutation 'R7018:Strc'
ID 545432
Institutional Source Beutler Lab
Gene Symbol Strc
Ensembl Gene ENSMUSG00000033498
Gene Name stereocilin
Synonyms DFNB16
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.235) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 121193729-121211851 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 121199539 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 1300 (I1300N)
Ref Sequence ENSEMBL: ENSMUSP00000039378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]
AlphaFold Q8VIM6
Predicted Effect probably damaging
Transcript: ENSMUST00000038389
AA Change: I1300N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: I1300N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 74 87 N/A INTRINSIC
low complexity region 108 119 N/A INTRINSIC
low complexity region 132 161 N/A INTRINSIC
low complexity region 277 291 N/A INTRINSIC
low complexity region 376 425 N/A INTRINSIC
low complexity region 610 635 N/A INTRINSIC
low complexity region 656 677 N/A INTRINSIC
low complexity region 728 746 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1168 1194 N/A INTRINSIC
low complexity region 1287 1302 N/A INTRINSIC
low complexity region 1560 1580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129136
SMART Domains Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

DomainStartEndE-ValueType
low complexity region 26 49 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150332
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Strc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01102:Strc APN 2 121,195,541 (GRCm39) missense probably benign 0.39
IGL01152:Strc APN 2 121,201,276 (GRCm39) missense probably benign
IGL01608:Strc APN 2 121,206,075 (GRCm39) missense probably benign 0.05
IGL01695:Strc APN 2 121,205,779 (GRCm39) missense probably damaging 1.00
IGL01715:Strc APN 2 121,196,218 (GRCm39) splice site probably null
IGL01906:Strc APN 2 121,208,115 (GRCm39) missense probably benign
IGL02135:Strc APN 2 121,195,315 (GRCm39) missense probably damaging 1.00
IGL02416:Strc APN 2 121,199,539 (GRCm39) missense probably damaging 1.00
IGL02455:Strc APN 2 121,206,272 (GRCm39) unclassified probably benign
IGL03029:Strc APN 2 121,194,525 (GRCm39) missense possibly damaging 0.95
IGL03176:Strc APN 2 121,202,661 (GRCm39) missense probably damaging 0.99
IGL03272:Strc APN 2 121,202,232 (GRCm39) missense probably damaging 1.00
3-1:Strc UTSW 2 121,204,161 (GRCm39) missense probably damaging 0.99
IGL02799:Strc UTSW 2 121,209,717 (GRCm39) missense probably damaging 1.00
PIT4283001:Strc UTSW 2 121,205,788 (GRCm39) missense probably damaging 1.00
R0022:Strc UTSW 2 121,198,874 (GRCm39) missense probably damaging 1.00
R0494:Strc UTSW 2 121,210,014 (GRCm39) missense probably damaging 0.99
R1065:Strc UTSW 2 121,197,132 (GRCm39) missense probably damaging 1.00
R1148:Strc UTSW 2 121,202,558 (GRCm39) intron probably benign
R1148:Strc UTSW 2 121,202,558 (GRCm39) intron probably benign
R1203:Strc UTSW 2 121,202,604 (GRCm39) missense possibly damaging 0.66
R1343:Strc UTSW 2 121,195,596 (GRCm39) missense probably benign 0.21
R1544:Strc UTSW 2 121,203,219 (GRCm39) splice site probably null
R1650:Strc UTSW 2 121,211,366 (GRCm39) start gained probably benign
R1840:Strc UTSW 2 121,209,777 (GRCm39) missense probably damaging 1.00
R1983:Strc UTSW 2 121,201,518 (GRCm39) missense possibly damaging 0.54
R2035:Strc UTSW 2 121,205,415 (GRCm39) missense probably damaging 1.00
R2058:Strc UTSW 2 121,209,368 (GRCm39) missense probably damaging 1.00
R2158:Strc UTSW 2 121,196,343 (GRCm39) missense probably benign 0.10
R2219:Strc UTSW 2 121,195,004 (GRCm39) missense probably damaging 1.00
R2680:Strc UTSW 2 121,195,592 (GRCm39) missense probably damaging 0.99
R4375:Strc UTSW 2 121,211,304 (GRCm39) missense unknown
R4563:Strc UTSW 2 121,196,286 (GRCm39) missense probably benign 0.02
R4578:Strc UTSW 2 121,208,484 (GRCm39) missense possibly damaging 0.94
R4607:Strc UTSW 2 121,203,426 (GRCm39) missense probably benign 0.31
R4651:Strc UTSW 2 121,204,829 (GRCm39) missense possibly damaging 0.67
R4652:Strc UTSW 2 121,204,829 (GRCm39) missense possibly damaging 0.67
R4790:Strc UTSW 2 121,206,075 (GRCm39) missense probably benign 0.05
R5480:Strc UTSW 2 121,195,300 (GRCm39) missense probably benign 0.00
R5580:Strc UTSW 2 121,205,493 (GRCm39) missense probably damaging 0.99
R5679:Strc UTSW 2 121,198,581 (GRCm39) missense probably benign 0.03
R5703:Strc UTSW 2 121,201,295 (GRCm39) missense probably benign
R5841:Strc UTSW 2 121,196,358 (GRCm39) missense probably benign 0.29
R5917:Strc UTSW 2 121,209,790 (GRCm39) missense probably benign
R5958:Strc UTSW 2 121,207,403 (GRCm39) missense possibly damaging 0.56
R6320:Strc UTSW 2 121,205,439 (GRCm39) missense probably benign 0.16
R6619:Strc UTSW 2 121,198,913 (GRCm39) missense probably damaging 0.99
R6695:Strc UTSW 2 121,207,705 (GRCm39) missense probably benign 0.35
R6970:Strc UTSW 2 121,208,495 (GRCm39) missense probably benign 0.41
R7045:Strc UTSW 2 121,201,207 (GRCm39) missense probably damaging 1.00
R7190:Strc UTSW 2 121,199,507 (GRCm39) missense probably benign 0.14
R7283:Strc UTSW 2 121,209,933 (GRCm39) missense probably damaging 0.99
R7694:Strc UTSW 2 121,207,577 (GRCm39) missense probably damaging 1.00
R7699:Strc UTSW 2 121,202,229 (GRCm39) missense possibly damaging 0.47
R7700:Strc UTSW 2 121,202,229 (GRCm39) missense possibly damaging 0.47
R7756:Strc UTSW 2 121,201,427 (GRCm39) missense probably benign
R7758:Strc UTSW 2 121,201,427 (GRCm39) missense probably benign
R7822:Strc UTSW 2 121,208,219 (GRCm39) missense probably benign 0.01
R7830:Strc UTSW 2 121,205,530 (GRCm39) missense probably damaging 0.99
R7953:Strc UTSW 2 121,207,844 (GRCm39) missense probably damaging 0.99
R8137:Strc UTSW 2 121,197,219 (GRCm39) missense probably damaging 0.98
R8394:Strc UTSW 2 121,209,490 (GRCm39) missense probably benign 0.00
R8427:Strc UTSW 2 121,208,012 (GRCm39) missense probably damaging 1.00
R8792:Strc UTSW 2 121,208,286 (GRCm39) missense probably damaging 0.99
R8874:Strc UTSW 2 121,205,353 (GRCm39) critical splice donor site probably null
R8947:Strc UTSW 2 121,201,470 (GRCm39) missense probably benign 0.09
R9285:Strc UTSW 2 121,195,279 (GRCm39) missense probably damaging 1.00
R9302:Strc UTSW 2 121,211,336 (GRCm39) missense unknown
R9386:Strc UTSW 2 121,198,211 (GRCm39) missense probably damaging 0.99
R9438:Strc UTSW 2 121,198,647 (GRCm39) missense probably damaging 1.00
R9581:Strc UTSW 2 121,207,928 (GRCm39) missense probably damaging 0.99
Z1176:Strc UTSW 2 121,209,525 (GRCm39) missense probably damaging 1.00
Z1176:Strc UTSW 2 121,206,002 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACTTGGGCCTCAAAGTGAAAG -3'
(R):5'- GAGATAGCCACTCTCTTTGCTC -3'

Sequencing Primer
(F):5'- CTTGGGCCTCAAAGTGAAAGAACAC -3'
(R):5'- CTGTCCCTTCAAGACATGGTGTG -3'
Posted On 2019-05-13