Mutagenetix > Incidental Mutation

Incidental Mutation 'R7018:Strc'

545432

Institutional Source

Beutler Lab

Gene Symbol

Strc

Ensembl Gene

ENSMUSG00000033498

Gene Name

stereocilin

Synonyms

DFNB16

MMRRC Submission

Accession Numbers

Genbank: NM_080459; MGI: 2153816

Essential gene?

Probably non essential (E-score: 0.206) question?

Stock #

R7018 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121363728-121387168 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 121369058 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1300 (I1300N)

Ref Sequence

ENSEMBL: ENSMUSP00000039378 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038389] [ENSMUST00000129136]

AlphaFold

Q8VIM6

Predicted Effect

probably damaging
Transcript: ENSMUST00000038389
AA Change: I1300N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000039378
Gene: ENSMUSG00000033498
AA Change: I1300N

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	74	87	N/A	INTRINSIC
low complexity region	108	119	N/A	INTRINSIC
low complexity region	132	161	N/A	INTRINSIC
low complexity region	277	291	N/A	INTRINSIC
low complexity region	376	425	N/A	INTRINSIC
low complexity region	610	635	N/A	INTRINSIC
low complexity region	656	677	N/A	INTRINSIC
low complexity region	728	746	N/A	INTRINSIC
low complexity region	898	921	N/A	INTRINSIC
low complexity region	1168	1194	N/A	INTRINSIC
low complexity region	1287	1302	N/A	INTRINSIC
low complexity region	1560	1580	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000129136

SMART Domains

Protein: ENSMUSP00000118211
Gene: ENSMUSG00000033498

Domain	Start	End	E-Value	Type
low complexity region	26	49	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134443

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150332

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit progressive hearing loss from P15 with abnormal cochlear outer hair cell stereociliary bundle morphology. [provided by MGI curators]

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apcdd1	G	T	18: 62,937,049	R129L	probably damaging	Het
Arhgef28	C	T	13: 97,965,435	V844I	probably damaging	Het
Arhgef5	T	C	6: 43,288,731	V1569A	probably damaging	Het
Atr	T	A	9: 95,866,694	S431T	probably benign	Het
Cdh11	T	C	8: 102,634,321	D795G	possibly damaging	Het
Crygf	T	C	1: 65,927,971	S85P	probably benign	Het
Diexf	A	G	1: 193,114,855	I563T	probably benign	Het
Dip2c	T	A	13: 9,659,278	Y1385N	probably damaging	Het
Dnah14	G	A	1: 181,626,944	V840I	possibly damaging	Het
Dsg1a	T	C	18: 20,328,738	F299L	possibly damaging	Het
Fgfr4	A	T	13: 55,166,200	S576C	probably damaging	Het
Frmd8	T	C	19: 5,869,518	D167G	probably damaging	Het
Gm5105	G	A	3: 138,049,558	T89I	unknown	Het
Grhl1	C	T	12: 24,575,997	S35L	possibly damaging	Het
Gsn	A	G	2: 35,293,506	E242G	probably benign	Het
Hcrtr1	A	G	4: 130,135,868	I140T	probably damaging	Het
Ifnlr1	T	C	4: 135,703,824	Y208H	possibly damaging	Het
Ighv1-58	T	C	12: 115,312,365	Y51C	probably damaging	Het
Iqcj	T	A	3: 68,041,247	Y21*	probably null	Het
Kcnc4	T	C	3: 107,458,862	Y10C	probably benign	Het
Kcnk7	G	T	19: 5,706,132	G129W	probably damaging	Het
Kcnq2	T	A	2: 181,081,724	R620*	probably null	Het
Klk13	C	A	7: 43,726,702	P267Q	probably benign	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
L3mbtl4	G	A	17: 68,486,943	R314H	probably damaging	Het
Lamc2	T	A	1: 153,136,742	M729L	probably benign	Het
Lyst	T	G	13: 13,743,459		probably null	Het
Med13l	G	A	5: 118,751,986	R1909H	probably damaging	Het
Mstn	T	A	1: 53,064,084	L193Q	possibly damaging	Het
Mylk	T	C	16: 35,000,426	V125A	possibly damaging	Het
Nalcn	T	A	14: 123,409,821	M547L	probably damaging	Het
Nckap5	A	G	1: 126,025,048	S1256P	probably damaging	Het
Nkain1	T	C	4: 130,532,118	Y189C	probably damaging	Het
Olfr1164	T	A	2: 88,093,256	I227F	probably benign	Het
Olfr193	A	G	16: 59,110,607	M1T	probably null	Het
Olfr490	T	G	7: 108,286,344	I261L	probably benign	Het
Olfr761	A	T	17: 37,952,502	I174N	probably damaging	Het
Oosp3	T	A	19: 11,699,419	D47E	probably benign	Het
Pcdh15	G	T	10: 74,466,354	G942W	probably damaging	Het
Pcyox1l	C	A	18: 61,707,554		probably benign	Het
Peg3	T	C	7: 6,708,839	E1128G	possibly damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plscr1	T	A	9: 92,264,662	V119D	probably damaging	Het
Prss56	A	T	1: 87,185,948	D258V	possibly damaging	Het
Ptpn23	T	G	9: 110,385,816	K85Q	possibly damaging	Het
Ranbp3l	C	A	15: 9,007,285	S7Y	probably benign	Het
Rnf31	T	C	14: 55,592,233	L85P	probably damaging	Het
Rptn	T	C	3: 93,397,900	C847R	possibly damaging	Het
Six4	T	A	12: 73,108,953	E413D	probably benign	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Sned1	T	C	1: 93,284,421	V1115A	probably damaging	Het
Spen	T	C	4: 141,493,444	K401E	unknown	Het
Srbd1	T	A	17: 86,136,415	R128W	possibly damaging	Het
Susd1	T	G	4: 59,390,627	T230P	probably benign	Het
Thumpd2	G	T	17: 81,055,897	S47*	probably null	Het
Tmprss11a	C	T	5: 86,428,570	V141I	probably damaging	Het
Tmprss15	T	C	16: 79,024,853	Y438C	possibly damaging	Het
Tnfrsf1a	T	C	6: 125,356,951	S56P	probably damaging	Het
Ttc39d	T	C	17: 80,216,181	W90R	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20rt	A	T	12: 65,225,762		probably null	Het
Zfp646	C	A	7: 127,882,322	Q1224K	probably benign	Het

Other mutations in Strc

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01102:Strc	APN	2	121365060	missense	probably benign	0.39
IGL01152:Strc	APN	2	121370795	missense	probably benign
IGL01608:Strc	APN	2	121375594	missense	probably benign	0.05
IGL01695:Strc	APN	2	121375298	missense	probably damaging	1.00
IGL01715:Strc	APN	2	121365737	splice site	probably null
IGL01906:Strc	APN	2	121377634	missense	probably benign
IGL02135:Strc	APN	2	121364834	missense	probably damaging	1.00
IGL02416:Strc	APN	2	121369058	missense	probably damaging	1.00
IGL02455:Strc	APN	2	121375791	unclassified	probably benign
IGL03029:Strc	APN	2	121364044	missense	possibly damaging	0.95
IGL03176:Strc	APN	2	121372180	missense	probably damaging	0.99
IGL03272:Strc	APN	2	121371751	missense	probably damaging	1.00
3-1:Strc	UTSW	2	121373680	missense	probably damaging	0.99
IGL02799:Strc	UTSW	2	121379236	missense	probably damaging	1.00
PIT4283001:Strc	UTSW	2	121375307	missense	probably damaging	1.00
R0022:Strc	UTSW	2	121368393	missense	probably damaging	1.00
R0494:Strc	UTSW	2	121379533	missense	probably damaging	0.99
R1065:Strc	UTSW	2	121366651	missense	probably damaging	1.00
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1148:Strc	UTSW	2	121372077	intron	probably benign
R1203:Strc	UTSW	2	121372123	missense	possibly damaging	0.66
R1343:Strc	UTSW	2	121365115	missense	probably benign	0.21
R1544:Strc	UTSW	2	121372738	splice site	probably null
R1650:Strc	UTSW	2	121380885	start gained	probably benign
R1840:Strc	UTSW	2	121379296	missense	probably damaging	1.00
R1983:Strc	UTSW	2	121371037	missense	possibly damaging	0.54
R2035:Strc	UTSW	2	121374934	missense	probably damaging	1.00
R2058:Strc	UTSW	2	121378887	missense	probably damaging	1.00
R2158:Strc	UTSW	2	121365862	missense	probably benign	0.10
R2219:Strc	UTSW	2	121364523	missense	probably damaging	1.00
R2680:Strc	UTSW	2	121365111	missense	probably damaging	0.99
R4375:Strc	UTSW	2	121380823	missense	unknown
R4563:Strc	UTSW	2	121365805	missense	probably benign	0.02
R4578:Strc	UTSW	2	121378003	missense	possibly damaging	0.94
R4607:Strc	UTSW	2	121372945	missense	probably benign	0.31
R4651:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4652:Strc	UTSW	2	121374348	missense	possibly damaging	0.67
R4790:Strc	UTSW	2	121375594	missense	probably benign	0.05
R5480:Strc	UTSW	2	121364819	missense	probably benign	0.00
R5580:Strc	UTSW	2	121375012	missense	probably damaging	0.99
R5679:Strc	UTSW	2	121368100	missense	probably benign	0.03
R5703:Strc	UTSW	2	121370814	missense	probably benign
R5841:Strc	UTSW	2	121365877	missense	probably benign	0.29
R5917:Strc	UTSW	2	121379309	missense	probably benign
R5958:Strc	UTSW	2	121376922	missense	possibly damaging	0.56
R6320:Strc	UTSW	2	121374958	missense	probably benign	0.16
R6619:Strc	UTSW	2	121368432	missense	probably damaging	0.99
R6695:Strc	UTSW	2	121377224	missense	probably benign	0.35
R6970:Strc	UTSW	2	121378014	missense	probably benign	0.41
R7045:Strc	UTSW	2	121370726	missense	probably damaging	1.00
R7190:Strc	UTSW	2	121369026	missense	probably benign	0.14
R7283:Strc	UTSW	2	121379452	missense	probably damaging	0.99
R7694:Strc	UTSW	2	121377096	missense	probably damaging	1.00
R7699:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7700:Strc	UTSW	2	121371748	missense	possibly damaging	0.47
R7756:Strc	UTSW	2	121370946	missense	probably benign
R7758:Strc	UTSW	2	121370946	missense	probably benign
R7822:Strc	UTSW	2	121377738	missense	probably benign	0.01
R7830:Strc	UTSW	2	121375049	missense	probably damaging	0.99
R7953:Strc	UTSW	2	121377363	missense	probably damaging	0.99
R8137:Strc	UTSW	2	121366738	missense	probably damaging	0.98
R8394:Strc	UTSW	2	121379009	missense	probably benign	0.00
R8427:Strc	UTSW	2	121377531	missense	probably damaging	1.00
R8792:Strc	UTSW	2	121377805	missense	probably damaging	0.99
R8874:Strc	UTSW	2	121374872	critical splice donor site	probably null
R8947:Strc	UTSW	2	121370989	missense	probably benign	0.09
R9285:Strc	UTSW	2	121364798	missense	probably damaging	1.00
R9302:Strc	UTSW	2	121380855	missense	unknown
R9386:Strc	UTSW	2	121367730	missense	probably damaging	0.99
R9438:Strc	UTSW	2	121368166	missense	probably damaging	1.00
R9581:Strc	UTSW	2	121377447	missense	probably damaging	0.99
Z1176:Strc	UTSW	2	121375521	missense	probably damaging	0.98
Z1176:Strc	UTSW	2	121379044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTGGGCCTCAAAGTGAAAG -3'
(R):5'- GAGATAGCCACTCTCTTTGCTC -3'

Sequencing Primer
(F):5'- CTTGGGCCTCAAAGTGAAAGAACAC -3'
(R):5'- CTGTCCCTTCAAGACATGGTGTG -3'

Posted On

2019-05-13