Incidental Mutation 'R7018:Kcnq2'
ID 545433
Institutional Source Beutler Lab
Gene Symbol Kcnq2
Ensembl Gene ENSMUSG00000016346
Gene Name potassium voltage-gated channel, subfamily Q, member 2
Synonyms Nmf134, KQT2
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180717372-180777093 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 180723517 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 620 (R620*)
Ref Sequence ENSEMBL: ENSMUSP00000143263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016491] [ENSMUST00000049792] [ENSMUST00000081528] [ENSMUST00000103047] [ENSMUST00000103048] [ENSMUST00000103050] [ENSMUST00000103051] [ENSMUST00000129695] [ENSMUST00000149964] [ENSMUST00000197015]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000016491
AA Change: R656*
SMART Domains Protein: ENSMUSP00000016491
Gene: ENSMUSG00000016346
AA Change: R656*

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.3e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 595 2e-59 PFAM
Pfam:KCNQ_channel 593 673 1.7e-22 PFAM
low complexity region 711 723 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000049792
AA Change: R651*
SMART Domains Protein: ENSMUSP00000052453
Gene: ENSMUSG00000016346
AA Change: R651*

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.2e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 436 565 3.1e-55 PFAM
Pfam:KCNQ_channel 587 668 6.8e-23 PFAM
low complexity region 706 718 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081528
SMART Domains Protein: ENSMUSP00000080243
Gene: ENSMUSG00000016346

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 4.3e-29 PFAM
Pfam:Ion_trans_2 237 317 1.7e-14 PFAM
Pfam:KCNQ_channel 436 564 2.3e-55 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103047
AA Change: R644*
SMART Domains Protein: ENSMUSP00000099336
Gene: ENSMUSG00000016346
AA Change: R644*

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 7.1e-29 PFAM
Pfam:Ion_trans_2 237 317 2.5e-14 PFAM
Pfam:KCNQ_channel 424 583 2e-59 PFAM
Pfam:KCNQ_channel 581 661 1.7e-22 PFAM
low complexity region 699 711 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103048
AA Change: R620*
SMART Domains Protein: ENSMUSP00000099337
Gene: ENSMUSG00000016346
AA Change: R620*

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 6.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.4e-14 PFAM
Pfam:KCNQ_channel 436 637 1.3e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000103049
AA Change: R572*
SMART Domains Protein: ENSMUSP00000099338
Gene: ENSMUSG00000016346
AA Change: R572*

DomainStartEndE-ValueType
Pfam:Ion_trans 35 268 3.7e-32 PFAM
Pfam:Ion_trans_2 181 261 1.1e-14 PFAM
Pfam:KCNQ_channel 392 584 1e-92 PFAM
Pfam:KCNQ2_u3 591 679 3.9e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 692 791 1.1e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103050
AA Change: R617*
SMART Domains Protein: ENSMUSP00000099339
Gene: ENSMUSG00000016346
AA Change: R617*

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000103051
AA Change: R630*
SMART Domains Protein: ENSMUSP00000099340
Gene: ENSMUSG00000016346
AA Change: R630*

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.9e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 446 647 1.7e-82 PFAM
low complexity region 685 697 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 747 849 1.7e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000129695
AA Change: R504*
SMART Domains Protein: ENSMUSP00000123488
Gene: ENSMUSG00000016346
AA Change: R504*

DomainStartEndE-ValueType
Pfam:Ion_trans 14 198 6.8e-29 PFAM
Pfam:Ion_trans_2 123 203 2.4e-14 PFAM
Pfam:KCNQ_channel 320 521 1.3e-82 PFAM
low complexity region 559 571 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 621 723 1.3e-51 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000149964
AA Change: R648*
SMART Domains Protein: ENSMUSP00000122915
Gene: ENSMUSG00000016346
AA Change: R648*

DomainStartEndE-ValueType
Pfam:Ion_trans 91 324 4.4e-32 PFAM
Pfam:Ion_trans_2 237 317 1.3e-14 PFAM
low complexity region 418 431 N/A INTRINSIC
Pfam:KCNQ_channel 466 659 6.2e-94 PFAM
Pfam:KCNQ2_u3 666 754 4.5e-39 PFAM
Pfam:KCNQC3-Ank-G_bd 767 866 1.2e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000197015
AA Change: R620*
SMART Domains Protein: ENSMUSP00000143263
Gene: ENSMUSG00000016346
AA Change: R620*

DomainStartEndE-ValueType
transmembrane domain 93 115 N/A INTRINSIC
Pfam:Ion_trans 128 312 8.7e-29 PFAM
Pfam:Ion_trans_2 237 317 2.9e-14 PFAM
Pfam:KCNQ_channel 436 637 1.7e-82 PFAM
low complexity region 675 687 N/A INTRINSIC
Pfam:KCNQC3-Ank-G_bd 737 839 1.6e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197599
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The M channel is a slowly activating and deactivating potassium channel that plays a critical role in the regulation of neuronal excitability. The M channel is formed by the association of the protein encoded by this gene and a related protein encoded by the KCNQ3 gene, both integral membrane proteins. M channel currents are inhibited by M1 muscarinic acetylcholine receptors and activated by retigabine, a novel anti-convulsant drug. Defects in this gene are a cause of benign familial neonatal convulsions type 1 (BFNC), also known as epilepsy, benign neonatal type 1 (EBN1). At least five transcript variants encoding five different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation die perinatally with pulmonary atelectasis. Heterozygous mice exhibit a hypersensitivity to the epileptic inducer pentylenetetrazole. Mice homozygous for a knock-in allele exhibit spontaneous seizures and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Kcnq2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Kcnq2 APN 2 180,751,582 (GRCm39) unclassified probably benign
IGL02064:Kcnq2 APN 2 180,750,819 (GRCm39) missense probably damaging 1.00
IGL02231:Kcnq2 APN 2 180,723,508 (GRCm39) missense probably benign 0.22
IGL02261:Kcnq2 APN 2 180,723,483 (GRCm39) missense probably damaging 0.98
IGL02510:Kcnq2 APN 2 180,723,154 (GRCm39) missense probably benign
IGL02583:Kcnq2 APN 2 180,723,295 (GRCm39) missense probably benign 0.01
IGL02627:Kcnq2 APN 2 180,724,120 (GRCm39) unclassified probably benign
IGL03303:Kcnq2 APN 2 180,724,182 (GRCm39) missense probably benign
R0269:Kcnq2 UTSW 2 180,738,767 (GRCm39) missense probably benign 0.00
R1535:Kcnq2 UTSW 2 180,776,618 (GRCm39) missense probably damaging 1.00
R1688:Kcnq2 UTSW 2 180,728,826 (GRCm39) missense probably damaging 1.00
R1776:Kcnq2 UTSW 2 180,742,350 (GRCm39) missense probably benign 0.01
R1946:Kcnq2 UTSW 2 180,730,244 (GRCm39) missense probably benign 0.09
R2105:Kcnq2 UTSW 2 180,723,145 (GRCm39) missense probably benign 0.03
R2382:Kcnq2 UTSW 2 180,753,900 (GRCm39) missense probably damaging 1.00
R2912:Kcnq2 UTSW 2 180,723,567 (GRCm39) missense probably damaging 1.00
R3826:Kcnq2 UTSW 2 180,746,693 (GRCm39) missense possibly damaging 0.56
R3898:Kcnq2 UTSW 2 180,751,479 (GRCm39) missense probably damaging 0.97
R4282:Kcnq2 UTSW 2 180,722,946 (GRCm39) missense probably damaging 1.00
R4938:Kcnq2 UTSW 2 180,728,766 (GRCm39) missense probably damaging 0.96
R4962:Kcnq2 UTSW 2 180,753,836 (GRCm39) missense possibly damaging 0.59
R5055:Kcnq2 UTSW 2 180,728,554 (GRCm39) intron probably benign
R5107:Kcnq2 UTSW 2 180,750,340 (GRCm39) intron probably benign
R5371:Kcnq2 UTSW 2 180,776,813 (GRCm39) missense probably damaging 1.00
R5557:Kcnq2 UTSW 2 180,776,690 (GRCm39) missense probably benign 0.07
R5839:Kcnq2 UTSW 2 180,751,544 (GRCm39) missense probably damaging 1.00
R5998:Kcnq2 UTSW 2 180,728,801 (GRCm39) missense probably damaging 1.00
R6084:Kcnq2 UTSW 2 180,729,449 (GRCm39) missense possibly damaging 0.53
R6207:Kcnq2 UTSW 2 180,755,026 (GRCm39) missense possibly damaging 0.49
R6744:Kcnq2 UTSW 2 180,727,099 (GRCm39) missense possibly damaging 0.94
R7266:Kcnq2 UTSW 2 180,776,885 (GRCm39) start codon destroyed probably null 0.92
R7291:Kcnq2 UTSW 2 180,730,172 (GRCm39) missense possibly damaging 0.69
R7319:Kcnq2 UTSW 2 180,750,895 (GRCm39) missense probably damaging 1.00
R7447:Kcnq2 UTSW 2 180,754,887 (GRCm39) missense probably damaging 0.97
R7573:Kcnq2 UTSW 2 180,723,382 (GRCm39) missense probably benign 0.04
R7897:Kcnq2 UTSW 2 180,722,934 (GRCm39) missense probably damaging 1.00
R8942:Kcnq2 UTSW 2 180,724,244 (GRCm39) missense probably damaging 1.00
R9381:Kcnq2 UTSW 2 180,751,562 (GRCm39) missense probably damaging 0.97
R9394:Kcnq2 UTSW 2 180,724,217 (GRCm39) missense probably benign
R9516:Kcnq2 UTSW 2 180,776,753 (GRCm39) missense probably benign 0.00
R9544:Kcnq2 UTSW 2 180,729,407 (GRCm39) missense probably damaging 1.00
R9592:Kcnq2 UTSW 2 180,728,813 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCGTACCAGTGAGCCATG -3'
(R):5'- TGACCAGTAAGCTCAGTGTTTG -3'

Sequencing Primer
(F):5'- TACCAGTGAGCCATGGTCTC -3'
(R):5'- CTCAGTGTTTGAGCTGTTGGAGTC -3'
Posted On 2019-05-13