Mutagenetix > Incidental Mutation

Incidental Mutation 'R7018:Rptn'

545435

Institutional Source

Beutler Lab

Gene Symbol

Rptn

Ensembl Gene

ENSMUSG00000041984

Gene Name

repetin

Synonyms

MMRRC Submission

045119-MU

Accession Numbers

Genbank: NM_009100; MGI: 1099055

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R7018 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93393699-93399442 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 93397900 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 847 (C847R)

Ref Sequence

ENSEMBL: ENSMUSP00000044998 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045912]

AlphaFold

P97347

Predicted Effect

possibly damaging
Transcript: ENSMUST00000045912
AA Change: C847R

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000044998
Gene: ENSMUSG00000041984
AA Change: C847R

Domain	Start	End	E-Value	Type
Pfam:S_100	4	46	3.2e-13	PFAM
Blast:EFh	53	81	5e-10	BLAST
low complexity region	189	204	N/A	INTRINSIC
low complexity region	237	252	N/A	INTRINSIC
Blast:CTD	318	461	1e-7	BLAST
low complexity region	1007	1041	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (64/64)

Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apcdd1	G	T	18: 62,937,049	R129L	probably damaging	Het
Arhgef28	C	T	13: 97,965,435	V844I	probably damaging	Het
Arhgef5	T	C	6: 43,288,731	V1569A	probably damaging	Het
Atr	T	A	9: 95,866,694	S431T	probably benign	Het
Cdh11	T	C	8: 102,634,321	D795G	possibly damaging	Het
Crygf	T	C	1: 65,927,971	S85P	probably benign	Het
Diexf	A	G	1: 193,114,855	I563T	probably benign	Het
Dip2c	T	A	13: 9,659,278	Y1385N	probably damaging	Het
Dnah14	G	A	1: 181,626,944	V840I	possibly damaging	Het
Dsg1a	T	C	18: 20,328,738	F299L	possibly damaging	Het
Fgfr4	A	T	13: 55,166,200	S576C	probably damaging	Het
Frmd8	T	C	19: 5,869,518	D167G	probably damaging	Het
Gm5105	G	A	3: 138,049,558	T89I	unknown	Het
Grhl1	C	T	12: 24,575,997	S35L	possibly damaging	Het
Gsn	A	G	2: 35,293,506	E242G	probably benign	Het
Hcrtr1	A	G	4: 130,135,868	I140T	probably damaging	Het
Ifnlr1	T	C	4: 135,703,824	Y208H	possibly damaging	Het
Ighv1-58	T	C	12: 115,312,365	Y51C	probably damaging	Het
Iqcj	T	A	3: 68,041,247	Y21*	probably null	Het
Kcnc4	T	C	3: 107,458,862	Y10C	probably benign	Het
Kcnk7	G	T	19: 5,706,132	G129W	probably damaging	Het
Kcnq2	T	A	2: 181,081,724	R620*	probably null	Het
Klk13	C	A	7: 43,726,702	P267Q	probably benign	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
L3mbtl4	G	A	17: 68,486,943	R314H	probably damaging	Het
Lamc2	T	A	1: 153,136,742	M729L	probably benign	Het
Lyst	T	G	13: 13,743,459		probably null	Het
Med13l	G	A	5: 118,751,986	R1909H	probably damaging	Het
Mstn	T	A	1: 53,064,084	L193Q	possibly damaging	Het
Mylk	T	C	16: 35,000,426	V125A	possibly damaging	Het
Nalcn	T	A	14: 123,409,821	M547L	probably damaging	Het
Nckap5	A	G	1: 126,025,048	S1256P	probably damaging	Het
Nkain1	T	C	4: 130,532,118	Y189C	probably damaging	Het
Olfr1164	T	A	2: 88,093,256	I227F	probably benign	Het
Olfr193	A	G	16: 59,110,607	M1T	probably null	Het
Olfr490	T	G	7: 108,286,344	I261L	probably benign	Het
Olfr761	A	T	17: 37,952,502	I174N	probably damaging	Het
Oosp3	T	A	19: 11,699,419	D47E	probably benign	Het
Pcdh15	G	T	10: 74,466,354	G942W	probably damaging	Het
Pcyox1l	C	A	18: 61,707,554		probably benign	Het
Peg3	T	C	7: 6,708,839	E1128G	possibly damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plscr1	T	A	9: 92,264,662	V119D	probably damaging	Het
Prss56	A	T	1: 87,185,948	D258V	possibly damaging	Het
Ptpn23	T	G	9: 110,385,816	K85Q	possibly damaging	Het
Ranbp3l	C	A	15: 9,007,285	S7Y	probably benign	Het
Rnf31	T	C	14: 55,592,233	L85P	probably damaging	Het
Six4	T	A	12: 73,108,953	E413D	probably benign	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Sned1	T	C	1: 93,284,421	V1115A	probably damaging	Het
Spen	T	C	4: 141,493,444	K401E	unknown	Het
Srbd1	T	A	17: 86,136,415	R128W	possibly damaging	Het
Strc	A	T	2: 121,369,058	I1300N	probably damaging	Het
Susd1	T	G	4: 59,390,627	T230P	probably benign	Het
Thumpd2	G	T	17: 81,055,897	S47*	probably null	Het
Tmprss11a	C	T	5: 86,428,570	V141I	probably damaging	Het
Tmprss15	T	C	16: 79,024,853	Y438C	possibly damaging	Het
Tnfrsf1a	T	C	6: 125,356,951	S56P	probably damaging	Het
Ttc39d	T	C	17: 80,216,181	W90R	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20rt	A	T	12: 65,225,762		probably null	Het
Zfp646	C	A	7: 127,882,322	Q1224K	probably benign	Het

Other mutations in Rptn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01062:Rptn	APN	3	93397182	missense	probably benign
IGL01070:Rptn	APN	3	93398176	missense	possibly damaging	0.86
IGL01625:Rptn	APN	3	93397894	missense	probably benign	0.18
IGL01678:Rptn	APN	3	93396811	missense	probably benign	0.00
IGL01716:Rptn	APN	3	93396710	missense	possibly damaging	0.53
IGL01767:Rptn	APN	3	93395639	missense	probably benign	0.00
IGL01872:Rptn	APN	3	93396847	missense	probably benign
IGL02000:Rptn	APN	3	93396428	missense	probably benign	0.01
IGL02066:Rptn	APN	3	93397129	missense	probably benign	0.01
IGL02090:Rptn	APN	3	93396734	missense	possibly damaging	0.85
IGL02116:Rptn	APN	3	93395097	missense	possibly damaging	0.88
IGL02216:Rptn	APN	3	93395773	missense	possibly damaging	0.73
IGL02368:Rptn	APN	3	93397171	missense	probably benign	0.18
IGL02820:Rptn	APN	3	93396920	missense	probably benign	0.01
IGL03323:Rptn	APN	3	93397153	missense	probably benign
IGL03404:Rptn	APN	3	93398129	missense	possibly damaging	0.53
D3080:Rptn	UTSW	3	93395828	missense	possibly damaging	0.85
H8786:Rptn	UTSW	3	93397873	missense	possibly damaging	0.53
IGL03097:Rptn	UTSW	3	93397373	missense	probably damaging	1.00
LCD18:Rptn	UTSW	3	93397541	missense	probably benign
PIT4431001:Rptn	UTSW	3	93397397	small deletion	probably benign
PIT4480001:Rptn	UTSW	3	93397670	missense	possibly damaging	0.85
R1024:Rptn	UTSW	3	93398225	missense	possibly damaging	0.72
R1119:Rptn	UTSW	3	93396245	missense	possibly damaging	0.96
R1727:Rptn	UTSW	3	93397138	missense	possibly damaging	0.73
R1901:Rptn	UTSW	3	93396710	missense	possibly damaging	0.53
R2247:Rptn	UTSW	3	93396829	missense	probably benign
R2921:Rptn	UTSW	3	93398708	missense	possibly damaging	0.96
R2922:Rptn	UTSW	3	93398708	missense	possibly damaging	0.96
R2923:Rptn	UTSW	3	93398708	missense	possibly damaging	0.96
R3901:Rptn	UTSW	3	93398357	missense	probably benign
R3936:Rptn	UTSW	3	93395576	missense	possibly damaging	0.79
R4304:Rptn	UTSW	3	93396931	missense	probably benign	0.33
R4491:Rptn	UTSW	3	93396511	nonsense	probably null
R4654:Rptn	UTSW	3	93397485	missense	possibly damaging	0.53
R4870:Rptn	UTSW	3	93396469	nonsense	probably null
R5246:Rptn	UTSW	3	93396833	missense	probably damaging	0.98
R5246:Rptn	UTSW	3	93397729	missense	possibly damaging	0.53
R5544:Rptn	UTSW	3	93398473	missense	possibly damaging	0.53
R5555:Rptn	UTSW	3	93396701	missense	probably benign
R5896:Rptn	UTSW	3	93398332	nonsense	probably null
R5956:Rptn	UTSW	3	93398027	missense	possibly damaging	0.53
R6192:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6209:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6224:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6226:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6227:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6230:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6247:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6258:Rptn	UTSW	3	93398130	missense	possibly damaging	0.53
R6393:Rptn	UTSW	3	93397199	missense	probably benign
R6513:Rptn	UTSW	3	93396112	missense	possibly damaging	0.73
R6854:Rptn	UTSW	3	93398123	missense	possibly damaging	0.53
R6855:Rptn	UTSW	3	93398251	missense	probably benign	0.33
R6884:Rptn	UTSW	3	93395789	missense	probably benign	0.33
R7241:Rptn	UTSW	3	93395954	missense	probably benign	0.01
R7337:Rptn	UTSW	3	93396905	missense	probably benign	0.03
R7754:Rptn	UTSW	3	93395921	missense	probably damaging	0.98
R7794:Rptn	UTSW	3	93395729	missense	probably benign
R7801:Rptn	UTSW	3	93398224	missense	possibly damaging	0.53
R8161:Rptn	UTSW	3	93396693	small deletion	probably benign
R8374:Rptn	UTSW	3	93396295	nonsense	probably null
R8671:Rptn	UTSW	3	93398194	missense	probably benign	0.18
R8804:Rptn	UTSW	3	93395843	missense	probably damaging	0.98
R8934:Rptn	UTSW	3	93395912	missense	probably benign	0.00
R8938:Rptn	UTSW	3	93395025	missense	possibly damaging	0.93
R9056:Rptn	UTSW	3	93397105	missense	probably benign	0.33
R9082:Rptn	UTSW	3	93395621	missense	possibly damaging	0.94
R9140:Rptn	UTSW	3	93396138	nonsense	probably null
R9310:Rptn	UTSW	3	93397077	missense	probably benign	0.00
R9392:Rptn	UTSW	3	93398414	missense	probably benign
R9403:Rptn	UTSW	3	93395042	missense	probably benign	0.17
R9564:Rptn	UTSW	3	93397229	missense	probably benign
R9748:Rptn	UTSW	3	93397454	missense	possibly damaging	0.85
X0018:Rptn	UTSW	3	93395941	nonsense	probably null
Z1088:Rptn	UTSW	3	93397427	missense	probably benign	0.01
Z1176:Rptn	UTSW	3	93395018	missense	probably benign	0.26
Z1177:Rptn	UTSW	3	93395643	nonsense	probably null
Z1177:Rptn	UTSW	3	93395712	missense	probably benign	0.01
Z1177:Rptn	UTSW	3	93397887	missense	possibly damaging	0.73

Predicted Primers

PCR Primer
(F):5'- ATCAGAATTCACACTGGCATCG -3'
(R):5'- ATGGGATCTCTGACTCTGGG -3'

Sequencing Primer
(F):5'- TCATTATGGTCAGACAGGTGGAC -3'
(R):5'- ACTCTGGGTTTGACGCAC -3'

Posted On

2019-05-13