Incidental Mutation 'R7018:Slc30a2'
ID 545441
Institutional Source Beutler Lab
Gene Symbol Slc30a2
Ensembl Gene ENSMUSG00000028836
Gene Name solute carrier family 30 (zinc transporter), member 2
Synonyms Znt2
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 134070492-134081795 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 134074726 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 161 (R161Q)
Ref Sequence ENSEMBL: ENSMUSP00000101500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081094] [ENSMUST00000105872] [ENSMUST00000105873] [ENSMUST00000105874]
AlphaFold Q2HJ10
Predicted Effect probably damaging
Transcript: ENSMUST00000081094
AA Change: R81Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079875
Gene: ENSMUSG00000028836
AA Change: R81Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105872
AA Change: R81Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101498
Gene: ENSMUSG00000028836
AA Change: R81Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105873
AA Change: R112Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101499
Gene: ENSMUSG00000028836
AA Change: R112Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 74 311 3.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105874
AA Change: R161Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101500
Gene: ENSMUSG00000028836
AA Change: R161Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 70 277 3.4e-51 PFAM
Meta Mutation Damage Score 0.8991 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc transporter that acts as a homodimer. The encoded protein plays a role in secreting zinc into breast milk. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Slc30a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Slc30a2 APN 4 134,070,611 (GRCm39) missense probably damaging 0.96
IGL01822:Slc30a2 APN 4 134,075,948 (GRCm39) missense probably damaging 0.98
IGL02808:Slc30a2 APN 4 134,071,360 (GRCm39) missense possibly damaging 0.65
R1415:Slc30a2 UTSW 4 134,076,660 (GRCm39) missense probably damaging 1.00
R2279:Slc30a2 UTSW 4 134,075,857 (GRCm39) missense probably benign
R4151:Slc30a2 UTSW 4 134,071,359 (GRCm39) missense probably benign 0.00
R4278:Slc30a2 UTSW 4 134,073,360 (GRCm39) missense probably null 1.00
R4783:Slc30a2 UTSW 4 134,071,317 (GRCm39) critical splice acceptor site probably null
R5823:Slc30a2 UTSW 4 134,073,289 (GRCm39) missense probably damaging 0.98
R7017:Slc30a2 UTSW 4 134,074,726 (GRCm39) missense probably damaging 1.00
R7021:Slc30a2 UTSW 4 134,074,726 (GRCm39) missense probably damaging 1.00
R7034:Slc30a2 UTSW 4 134,074,653 (GRCm39) missense possibly damaging 0.80
R7053:Slc30a2 UTSW 4 134,074,726 (GRCm39) missense probably damaging 1.00
R7056:Slc30a2 UTSW 4 134,074,726 (GRCm39) missense probably damaging 1.00
R7057:Slc30a2 UTSW 4 134,074,726 (GRCm39) missense probably damaging 1.00
R7067:Slc30a2 UTSW 4 134,071,529 (GRCm39) critical splice donor site probably null
R7138:Slc30a2 UTSW 4 134,071,429 (GRCm39) missense probably benign 0.00
R7275:Slc30a2 UTSW 4 134,076,581 (GRCm39) splice site probably null
R7289:Slc30a2 UTSW 4 134,071,524 (GRCm39) missense possibly damaging 0.69
R8015:Slc30a2 UTSW 4 134,074,761 (GRCm39) missense probably benign 0.01
R8359:Slc30a2 UTSW 4 134,076,690 (GRCm39) missense probably damaging 0.98
Z1176:Slc30a2 UTSW 4 134,071,400 (GRCm39) missense probably benign 0.00
Z1177:Slc30a2 UTSW 4 134,074,766 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTACCCAGACATCGTTGGTG -3'
(R):5'- AGCACAGACTCCTTCCCTTG -3'

Sequencing Primer
(F):5'- GAGACCCAGGCCCTGACTTTAC -3'
(R):5'- CCTTCCCTTGGGAGCTGATG -3'
Posted On 2019-05-13