Incidental Mutation 'R7018:Slc30a2'
ID545441
Institutional Source Beutler Lab
Gene Symbol Slc30a2
Ensembl Gene ENSMUSG00000028836
Gene Namesolute carrier family 30 (zinc transporter), member 2
SynonymsZnt2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R7018 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location134343181-134354484 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 134347415 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 161 (R161Q)
Ref Sequence ENSEMBL: ENSMUSP00000101500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081094] [ENSMUST00000105872] [ENSMUST00000105873] [ENSMUST00000105874]
Predicted Effect probably damaging
Transcript: ENSMUST00000081094
AA Change: R81Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079875
Gene: ENSMUSG00000028836
AA Change: R81Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105872
AA Change: R81Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101498
Gene: ENSMUSG00000028836
AA Change: R81Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 1 280 6e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105873
AA Change: R112Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101499
Gene: ENSMUSG00000028836
AA Change: R112Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 74 311 3.1e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105874
AA Change: R161Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101500
Gene: ENSMUSG00000028836
AA Change: R161Q

DomainStartEndE-ValueType
Pfam:Cation_efflux 70 277 3.4e-51 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc transporter that acts as a homodimer. The encoded protein plays a role in secreting zinc into breast milk. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 62,937,049 R129L probably damaging Het
Arhgef28 C T 13: 97,965,435 V844I probably damaging Het
Arhgef5 T C 6: 43,288,731 V1569A probably damaging Het
Atr T A 9: 95,866,694 S431T probably benign Het
Cdh11 T C 8: 102,634,321 D795G possibly damaging Het
Crygf T C 1: 65,927,971 S85P probably benign Het
Diexf A G 1: 193,114,855 I563T probably benign Het
Dip2c T A 13: 9,659,278 Y1385N probably damaging Het
Dnah14 G A 1: 181,626,944 V840I possibly damaging Het
Dsg1a T C 18: 20,328,738 F299L possibly damaging Het
Fgfr4 A T 13: 55,166,200 S576C probably damaging Het
Frmd8 T C 19: 5,869,518 D167G probably damaging Het
Gm5105 G A 3: 138,049,558 T89I unknown Het
Grhl1 C T 12: 24,575,997 S35L possibly damaging Het
Gsn A G 2: 35,293,506 E242G probably benign Het
Hcrtr1 A G 4: 130,135,868 I140T probably damaging Het
Ifnlr1 T C 4: 135,703,824 Y208H possibly damaging Het
Ighv1-58 T C 12: 115,312,365 Y51C probably damaging Het
Iqcj T A 3: 68,041,247 Y21* probably null Het
Kcnc4 T C 3: 107,458,862 Y10C probably benign Het
Kcnk7 G T 19: 5,706,132 G129W probably damaging Het
Kcnq2 T A 2: 181,081,724 R620* probably null Het
Klk13 C A 7: 43,726,702 P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Lamc2 T A 1: 153,136,742 M729L probably benign Het
Lyst T G 13: 13,743,459 probably null Het
Med13l G A 5: 118,751,986 R1909H probably damaging Het
Mstn T A 1: 53,064,084 L193Q possibly damaging Het
Mylk T C 16: 35,000,426 V125A possibly damaging Het
Nalcn T A 14: 123,409,821 M547L probably damaging Het
Nckap5 A G 1: 126,025,048 S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 Y189C probably damaging Het
Olfr1164 T A 2: 88,093,256 I227F probably benign Het
Olfr193 A G 16: 59,110,607 M1T probably null Het
Olfr490 T G 7: 108,286,344 I261L probably benign Het
Olfr761 A T 17: 37,952,502 I174N probably damaging Het
Oosp3 T A 19: 11,699,419 D47E probably benign Het
Pcdh15 G T 10: 74,466,354 G942W probably damaging Het
Pcyox1l C A 18: 61,707,554 probably benign Het
Peg3 T C 7: 6,708,839 E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plscr1 T A 9: 92,264,662 V119D probably damaging Het
Prss56 A T 1: 87,185,948 D258V possibly damaging Het
Ptpn23 T G 9: 110,385,816 K85Q possibly damaging Het
Ranbp3l C A 15: 9,007,285 S7Y probably benign Het
Rnf31 T C 14: 55,592,233 L85P probably damaging Het
Rptn T C 3: 93,397,900 C847R possibly damaging Het
Six4 T A 12: 73,108,953 E413D probably benign Het
Sned1 T C 1: 93,284,421 V1115A probably damaging Het
Spen T C 4: 141,493,444 K401E unknown Het
Srbd1 T A 17: 86,136,415 R128W possibly damaging Het
Strc A T 2: 121,369,058 I1300N probably damaging Het
Susd1 T G 4: 59,390,627 T230P probably benign Het
Thumpd2 G T 17: 81,055,897 S47* probably null Het
Tmprss11a C T 5: 86,428,570 V141I probably damaging Het
Tmprss15 T C 16: 79,024,853 Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,356,951 S56P probably damaging Het
Ttc39d T C 17: 80,216,181 W90R probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20rt A T 12: 65,225,762 probably null Het
Zfp646 C A 7: 127,882,322 Q1224K probably benign Het
Other mutations in Slc30a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Slc30a2 APN 4 134343300 missense probably damaging 0.96
IGL01822:Slc30a2 APN 4 134348637 missense probably damaging 0.98
IGL02808:Slc30a2 APN 4 134344049 missense possibly damaging 0.65
R1415:Slc30a2 UTSW 4 134349349 missense probably damaging 1.00
R2279:Slc30a2 UTSW 4 134348546 missense probably benign
R4151:Slc30a2 UTSW 4 134344048 missense probably benign 0.00
R4278:Slc30a2 UTSW 4 134346049 missense probably null 1.00
R4783:Slc30a2 UTSW 4 134344006 critical splice acceptor site probably null
R5823:Slc30a2 UTSW 4 134345978 missense probably damaging 0.98
R7017:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7021:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7034:Slc30a2 UTSW 4 134347342 missense possibly damaging 0.80
R7053:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7056:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7057:Slc30a2 UTSW 4 134347415 missense probably damaging 1.00
R7067:Slc30a2 UTSW 4 134344218 critical splice donor site probably null
R7138:Slc30a2 UTSW 4 134344118 missense probably benign 0.00
R7275:Slc30a2 UTSW 4 134349270 splice site probably null
R7289:Slc30a2 UTSW 4 134344213 missense possibly damaging 0.69
R8015:Slc30a2 UTSW 4 134347450 missense probably benign 0.01
Z1176:Slc30a2 UTSW 4 134344089 missense probably benign 0.00
Z1177:Slc30a2 UTSW 4 134347455 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GTACCCAGACATCGTTGGTG -3'
(R):5'- AGCACAGACTCCTTCCCTTG -3'

Sequencing Primer
(F):5'- GAGACCCAGGCCCTGACTTTAC -3'
(R):5'- CCTTCCCTTGGGAGCTGATG -3'
Posted On2019-05-13