Incidental Mutation 'R7018:Ifnlr1'
ID 545442
Institutional Source Beutler Lab
Gene Symbol Ifnlr1
Ensembl Gene ENSMUSG00000062157
Gene Name interferon lambda receptor 1
Synonyms IFNLR1, Il28ra, CRF2-12
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 135413598-135435492 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 135431135 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 208 (Y208H)
Ref Sequence ENSEMBL: ENSMUSP00000074009 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074408]
AlphaFold Q8CGK5
Predicted Effect possibly damaging
Transcript: ENSMUST00000074408
AA Change: Y208H

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000074009
Gene: ENSMUSG00000062157
AA Change: Y208H

DomainStartEndE-ValueType
low complexity region 10 15 N/A INTRINSIC
FN3 24 108 7.75e0 SMART
transmembrane domain 226 248 N/A INTRINSIC
low complexity region 320 337 N/A INTRINSIC
low complexity region 376 397 N/A INTRINSIC
low complexity region 482 505 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice are viable and normal with respect to viral infection, however antiviral response evoked by TLRs are significantly reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Arhgef5 T C 6: 43,265,665 (GRCm39) V1569A probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Ifnlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Ifnlr1 APN 4 135,431,596 (GRCm39) missense probably benign 0.28
IGL01637:Ifnlr1 APN 4 135,413,856 (GRCm39) missense possibly damaging 0.63
IGL02090:Ifnlr1 APN 4 135,432,578 (GRCm39) missense probably benign 0.23
R0677:Ifnlr1 UTSW 4 135,432,945 (GRCm39) missense possibly damaging 0.78
R0723:Ifnlr1 UTSW 4 135,428,524 (GRCm39) splice site probably benign
R0762:Ifnlr1 UTSW 4 135,428,640 (GRCm39) missense possibly damaging 0.90
R1169:Ifnlr1 UTSW 4 135,432,419 (GRCm39) missense probably benign 0.00
R1303:Ifnlr1 UTSW 4 135,431,528 (GRCm39) missense possibly damaging 0.67
R1819:Ifnlr1 UTSW 4 135,413,834 (GRCm39) start gained probably benign
R1957:Ifnlr1 UTSW 4 135,413,881 (GRCm39) missense probably damaging 1.00
R2041:Ifnlr1 UTSW 4 135,433,148 (GRCm39) missense possibly damaging 0.51
R2509:Ifnlr1 UTSW 4 135,432,559 (GRCm39) missense probably damaging 1.00
R2510:Ifnlr1 UTSW 4 135,432,559 (GRCm39) missense probably damaging 1.00
R2511:Ifnlr1 UTSW 4 135,432,559 (GRCm39) missense probably damaging 1.00
R3020:Ifnlr1 UTSW 4 135,433,041 (GRCm39) small deletion probably benign
R3944:Ifnlr1 UTSW 4 135,428,539 (GRCm39) missense probably damaging 1.00
R4495:Ifnlr1 UTSW 4 135,433,079 (GRCm39) missense probably damaging 0.98
R4804:Ifnlr1 UTSW 4 135,432,647 (GRCm39) missense possibly damaging 0.50
R4938:Ifnlr1 UTSW 4 135,432,593 (GRCm39) missense probably benign 0.35
R5070:Ifnlr1 UTSW 4 135,431,509 (GRCm39) missense probably benign 0.00
R5073:Ifnlr1 UTSW 4 135,432,457 (GRCm39) missense probably benign 0.06
R5493:Ifnlr1 UTSW 4 135,432,877 (GRCm39) missense probably benign 0.25
R5913:Ifnlr1 UTSW 4 135,432,581 (GRCm39) missense probably damaging 1.00
R5913:Ifnlr1 UTSW 4 135,432,580 (GRCm39) missense probably damaging 1.00
R5959:Ifnlr1 UTSW 4 135,432,652 (GRCm39) missense possibly damaging 0.94
R6032:Ifnlr1 UTSW 4 135,432,937 (GRCm39) missense probably benign 0.03
R6032:Ifnlr1 UTSW 4 135,432,937 (GRCm39) missense probably benign 0.03
R6136:Ifnlr1 UTSW 4 135,431,108 (GRCm39) missense possibly damaging 0.92
R7651:Ifnlr1 UTSW 4 135,417,919 (GRCm39) missense possibly damaging 0.66
R8945:Ifnlr1 UTSW 4 135,431,609 (GRCm39) missense probably damaging 1.00
R8976:Ifnlr1 UTSW 4 135,428,650 (GRCm39) missense probably damaging 1.00
R9188:Ifnlr1 UTSW 4 135,426,171 (GRCm39) missense probably damaging 1.00
R9427:Ifnlr1 UTSW 4 135,426,142 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGAAAGCTCCGTGGTCCC -3'
(R):5'- CTGCTCAATCCCAGGAGAATAAG -3'

Sequencing Primer
(F):5'- TGGCCACTTCCACCACCG -3'
(R):5'- CATTCTAGTGGAAGCCAAGTCTC -3'
Posted On 2019-05-13