Incidental Mutation 'R7018:Arhgef5'
ID 545446
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor 5
Synonyms 2210412D05Rik
MMRRC Submission 045119-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 43242578-43266254 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 43265665 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1569 (V1569A)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: V1569A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: V1569A

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 63,070,120 (GRCm39) R129L probably damaging Het
Arhgef28 C T 13: 98,101,943 (GRCm39) V844I probably damaging Het
Atr T A 9: 95,748,747 (GRCm39) S431T probably benign Het
Cdh11 T C 8: 103,360,953 (GRCm39) D795G possibly damaging Het
Crygf T C 1: 65,967,130 (GRCm39) S85P probably benign Het
Dip2c T A 13: 9,709,314 (GRCm39) Y1385N probably damaging Het
Dnah14 G A 1: 181,454,509 (GRCm39) V840I possibly damaging Het
Dsg1a T C 18: 20,461,795 (GRCm39) F299L possibly damaging Het
Fgfr4 A T 13: 55,314,013 (GRCm39) S576C probably damaging Het
Frmd8 T C 19: 5,919,546 (GRCm39) D167G probably damaging Het
Gm5105 G A 3: 137,755,319 (GRCm39) T89I unknown Het
Grhl1 C T 12: 24,625,996 (GRCm39) S35L possibly damaging Het
Gsn A G 2: 35,183,518 (GRCm39) E242G probably benign Het
Hcrtr1 A G 4: 130,029,661 (GRCm39) I140T probably damaging Het
Ifnlr1 T C 4: 135,431,135 (GRCm39) Y208H possibly damaging Het
Ighv1-58 T C 12: 115,275,985 (GRCm39) Y51C probably damaging Het
Iqcj T A 3: 67,948,580 (GRCm39) Y21* probably null Het
Kcnc4 T C 3: 107,366,178 (GRCm39) Y10C probably benign Het
Kcnk7 G T 19: 5,756,160 (GRCm39) G129W probably damaging Het
Kcnq2 T A 2: 180,723,517 (GRCm39) R620* probably null Het
Klk13 C A 7: 43,376,126 (GRCm39) P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,758,813 (GRCm39) probably benign Het
L3mbtl4 G A 17: 68,793,938 (GRCm39) R314H probably damaging Het
Lamc2 T A 1: 153,012,488 (GRCm39) M729L probably benign Het
Lyst T G 13: 13,918,044 (GRCm39) probably null Het
Med13l G A 5: 118,890,051 (GRCm39) R1909H probably damaging Het
Mstn T A 1: 53,103,243 (GRCm39) L193Q possibly damaging Het
Mylk T C 16: 34,820,796 (GRCm39) V125A possibly damaging Het
Nalcn T A 14: 123,647,233 (GRCm39) M547L probably damaging Het
Nckap5 A G 1: 125,952,785 (GRCm39) S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 (GRCm38) Y189C probably damaging Het
Oosp3 T A 19: 11,676,783 (GRCm39) D47E probably benign Het
Or14j8 A T 17: 38,263,393 (GRCm39) I174N probably damaging Het
Or5d37 T A 2: 87,923,600 (GRCm39) I227F probably benign Het
Or5h25 A G 16: 58,930,970 (GRCm39) M1T probably null Het
Or5p66 T G 7: 107,885,551 (GRCm39) I261L probably benign Het
Pcdh15 G T 10: 74,302,186 (GRCm39) G942W probably damaging Het
Pcyox1l C A 18: 61,840,625 (GRCm39) probably benign Het
Peg3 T C 7: 6,711,838 (GRCm39) E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 110,350,827 (GRCm39) probably benign Het
Plscr1 T A 9: 92,146,715 (GRCm39) V119D probably damaging Het
Prss56 A T 1: 87,113,670 (GRCm39) D258V possibly damaging Het
Ptpn23 T G 9: 110,214,884 (GRCm39) K85Q possibly damaging Het
Ranbp3l C A 15: 9,037,159 (GRCm39) S7Y probably benign Het
Rnf31 T C 14: 55,829,690 (GRCm39) L85P probably damaging Het
Rptn T C 3: 93,305,207 (GRCm39) C847R possibly damaging Het
Six4 T A 12: 73,155,727 (GRCm39) E413D probably benign Het
Slc30a2 G A 4: 134,074,726 (GRCm39) R161Q probably damaging Het
Sned1 T C 1: 93,212,143 (GRCm39) V1115A probably damaging Het
Spen T C 4: 141,220,755 (GRCm39) K401E unknown Het
Srbd1 T A 17: 86,443,843 (GRCm39) R128W possibly damaging Het
Strc A T 2: 121,199,539 (GRCm39) I1300N probably damaging Het
Susd1 T G 4: 59,390,627 (GRCm39) T230P probably benign Het
Thumpd2 G T 17: 81,363,326 (GRCm39) S47* probably null Het
Tmprss11a C T 5: 86,576,429 (GRCm39) V141I probably damaging Het
Tmprss15 T C 16: 78,821,741 (GRCm39) Y438C possibly damaging Het
Tnfrsf1a T C 6: 125,333,914 (GRCm39) S56P probably damaging Het
Ttc39d T C 17: 80,523,610 (GRCm39) W90R probably benign Het
Utp25 A G 1: 192,797,163 (GRCm39) I563T probably benign Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Wdr20rt A T 12: 65,272,536 (GRCm39) probably null Het
Zfp646 C A 7: 127,481,494 (GRCm39) Q1224K probably benign Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43,257,203 (GRCm39) nonsense probably null
IGL01341:Arhgef5 APN 6 43,260,925 (GRCm39) missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43,250,962 (GRCm39) missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43,251,538 (GRCm39) missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43,249,345 (GRCm39) missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43,252,064 (GRCm39) missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43,260,916 (GRCm39) missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43,249,869 (GRCm39) nonsense probably null
IGL03292:Arhgef5 APN 6 43,257,180 (GRCm39) missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43,250,934 (GRCm39) missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43,257,585 (GRCm39) missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43,242,555 (GRCm39) splice site probably null
R0206:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43,250,275 (GRCm39) missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43,250,330 (GRCm39) missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43,260,846 (GRCm39) missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43,251,568 (GRCm39) missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43,256,449 (GRCm39) missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43,250,337 (GRCm39) missense probably benign
R1663:Arhgef5 UTSW 6 43,253,899 (GRCm39) missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43,257,133 (GRCm39) missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43,265,616 (GRCm39) missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43,250,022 (GRCm39) missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43,260,252 (GRCm39) missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43,251,354 (GRCm39) missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43,250,724 (GRCm39) missense probably benign
R4205:Arhgef5 UTSW 6 43,250,766 (GRCm39) missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43,256,432 (GRCm39) missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43,251,027 (GRCm39) missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43,252,033 (GRCm39) missense probably benign
R4636:Arhgef5 UTSW 6 43,251,876 (GRCm39) missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43,260,117 (GRCm39) missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43,250,484 (GRCm39) missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43,249,762 (GRCm39) missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43,250,148 (GRCm39) missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43,250,634 (GRCm39) missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43,242,614 (GRCm39) start gained probably benign
R5251:Arhgef5 UTSW 6 43,249,815 (GRCm39) missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43,249,273 (GRCm39) missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43,250,997 (GRCm39) missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43,252,874 (GRCm39) missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43,252,038 (GRCm39) missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43,252,068 (GRCm39) missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43,251,966 (GRCm39) missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43,251,895 (GRCm39) missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43,257,933 (GRCm39) missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43,250,232 (GRCm39) missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43,251,351 (GRCm39) missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43,252,276 (GRCm39) missense probably benign 0.00
R7180:Arhgef5 UTSW 6 43,252,142 (GRCm39) missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43,250,166 (GRCm39) nonsense probably null
R7358:Arhgef5 UTSW 6 43,256,507 (GRCm39) missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43,257,216 (GRCm39) missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43,257,605 (GRCm39) nonsense probably null
R7503:Arhgef5 UTSW 6 43,250,933 (GRCm39) missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43,251,691 (GRCm39) missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43,250,728 (GRCm39) missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43,252,069 (GRCm39) nonsense probably null
R7950:Arhgef5 UTSW 6 43,250,859 (GRCm39) missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43,260,885 (GRCm39) missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43,252,119 (GRCm39) missense probably benign 0.00
R8203:Arhgef5 UTSW 6 43,257,579 (GRCm39) missense probably damaging 1.00
R8318:Arhgef5 UTSW 6 43,252,933 (GRCm39) critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43,264,558 (GRCm39) missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43,260,940 (GRCm39) missense
R9610:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43,257,890 (GRCm39) missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43,251,736 (GRCm39) missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43,250,527 (GRCm39) missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43,256,407 (GRCm39) missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43,250,635 (GRCm39) missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43,249,342 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATTCAGCCTCAGGATGTCG -3'
(R):5'- GAACAAGGGACTGAGCTCATCC -3'

Sequencing Primer
(F):5'- CAGCCTCAGGATGTCGATTAATTTTC -3'
(R):5'- CATCCTTGGGATTTCAGAAGGCC -3'
Posted On 2019-05-13